1-215602098-CCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA-C

Position:

• chr1-215602098-CCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA-C

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_016121.5(KCTD3):​c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA​(p.Pro346fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: KCTD3 NM_016121.5 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 9.56

Genes affected

KCTD3 (HGNC:21305): (potassium channel tetramerization domain containing 3) This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KCTD3	NM_016121.5	c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro346fs	frameshift_variant	12/18	ENST00000259154.9	NP_057205.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KCTD3	ENST00000259154.9	c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro346fs	frameshift_variant	12/18	1	NM_016121.5	ENSP00000259154.2
KCTD3	ENST00000452413.1	c.-72_-35delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA		upstream_gene_variant		3		ENSP00000399962.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Seizure;C1837397:Severe global developmental delay;C5231391:Congenital cerebellar hypoplasia Pathogenic:1

Likely pathogenic, no assertion criteria provided

research

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Dec 01, 2014

- -

Autism, susceptibility to, 15 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Apr 04, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs730882243; hg19: chr1-215775440;