rs730882243

Variant names:

• chr1-215602098-CCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA-C
• rs730882243
• NM_016121.5:c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_016121.5(KCTD3):​c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA​(p.Pro346ThrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: KCTD3 NM_016121.5 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 9.56
• Publications: 6 publications found

Genes affected

KCTD3 (HGNC:21305): (potassium channel tetramerization domain containing 3) This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_016121.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCTD3	NM_016121.5	MANE Select	c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro346ThrfsTer4	frameshift	Exon 12 of 18	NP_057205.2
	KCTD3	NM_001319294.2		c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro346ThrfsTer4	frameshift	Exon 12 of 18	NP_001306223.1
	KCTD3	NM_001319295.2		c.730_767delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro244ThrfsTer4	frameshift	Exon 12 of 18	NP_001306224.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCTD3	ENST00000259154.9	TSL:1 MANE Select	c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro346ThrfsTer4	frameshift	Exon 12 of 18	ENSP00000259154.2
	KCTD3	ENST00000964520.1		c.1057_1094delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro353ThrfsTer4	frameshift	Exon 12 of 18	ENSP00000634579.1
	KCTD3	ENST00000964519.1		c.1036_1073delCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA	p.Pro346ThrfsTer4	frameshift	Exon 13 of 19	ENSP00000634578.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Autism, susceptibility to, 15 (1)
1	-	-	Seizure;C1837397:Severe global developmental delay;C5231391:Congenital cerebellar hypoplasia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs730882243; hg19: chr1-215775440;