1-225519331-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC-ATCCAGGCGTTCCTGCCGC

Variant names:

• chr1-225519331-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC-A
• rs71170086
• NM_018212.6:c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4 BS2

The NM_018212.6(ENAH):​c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA​(p.Glu211_Leu222del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000764 in 149,240 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00076 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00062 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: ENAH NM_018212.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.04

Genes affected

ENAH (HGNC:18271): (ENAH actin regulator) This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_018212.6.
• BS2: High AC in GnomAd4 at 114 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ENAH	NM_018212.6	c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222del	disruptive_inframe_deletion	Exon 5 of 14	ENST00000366843.7	NP_060682.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ENAH	ENST00000366843.7	c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222del	disruptive_inframe_deletion	Exon 5 of 14	1	NM_018212.6	ENSP00000355808.2

Frequencies

GnomAD3 genomes AF: 0.000764 AC: 114 AN: 149146 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00136

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000466

Gnomad ASJ AF: 0.000294

Gnomad EAS AF: 0.00161

Gnomad SAS AF: 0.000874

Gnomad FIN AF: 0.000195

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000520

Gnomad OTH AF: 0.000983

GnomAD3 exomes AF: 0.000404 AC: 101 AN: 250234 Hom.: 1 AF XY: 0.000406 AC XY: 55 AN XY: 135350

Gnomad AFR exome AF: 0.000680

Gnomad AMR exome AF: 0.000116

Gnomad ASJ exome AF: 0.000299

Gnomad EAS exome AF: 0.00126

Gnomad SAS exome AF: 0.000295

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000433

Gnomad OTH exome AF: 0.000327

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000620 AC: 906 AN: 1461052 Hom.: 1 AF XY: 0.000608 AC XY: 442 AN XY: 726882

Gnomad4 AFR exome AF: 0.00144

Gnomad4 AMR exome AF: 0.000224

Gnomad4 ASJ exome AF: 0.000804

Gnomad4 EAS exome AF: 0.00378

Gnomad4 SAS exome AF: 0.000395

Gnomad4 FIN exome AF: 0.0000938

Gnomad4 NFE exome AF: 0.000544

Gnomad4 OTH exome AF: 0.000497

GnomAD4 genome AF: 0.000764 AC: 114 AN: 149240 Hom.: 0 Cov.: 31 AF XY: 0.000728 AC XY: 53 AN XY: 72768

Gnomad4 AFR AF: 0.00136

Gnomad4 AMR AF: 0.000465

Gnomad4 ASJ AF: 0.000294

Gnomad4 EAS AF: 0.00162

Gnomad4 SAS AF: 0.000877

Gnomad4 FIN AF: 0.000195

Gnomad4 NFE AF: 0.000520

Gnomad4 OTH AF: 0.000973

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71170086; hg19: chr1-225707033;