1-225519331-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC-ATCCAGGCGTTCCTGCCGC

Variant names:

• chr1-225519331-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC-A
• rs71170086
• NM_018212.6:c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 2P and 4B. PM4 BS2

The NM_018212.6(ENAH):​c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA​(p.Glu211_Leu222del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000764 in 149,240 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00076 (0 hom., cov: 31)
  • Exomes 𝑓: 0.00062 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: ENAH NM_018212.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.04
• Publications: 5 publications found

Genes affected

ENAH (HGNC:18271): (ENAH actin regulator) This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_018212.6.
• BS2: High AC in GnomAd4 at 114 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018212.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENAH	NM_018212.6	MANE Select	c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222del	disruptive_inframe_deletion	Exon 5 of 14	NP_060682.2
	ENAH	NM_001420159.1		c.690_725delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu230_Leu241del	disruptive_inframe_deletion	Exon 6 of 16	NP_001407088.1
	ENAH	NM_001420160.1		c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222del	disruptive_inframe_deletion	Exon 5 of 15	NP_001407089.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENAH	ENST00000366843.7	TSL:1 MANE Select	c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222del	disruptive_inframe_deletion	Exon 5 of 14	ENSP00000355808.2	Q8N8S7-2
	ENAH	ENST00000366844.7	TSL:1	c.633_668delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222del	disruptive_inframe_deletion	Exon 5 of 15	ENSP00000355809.2	Q8N8S7-1
	ENAH	ENST00000497899.6	TSL:1	c.483_518delGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu161_Leu172del	disruptive_inframe_deletion	Exon 4 of 4	ENSP00000489106.1	A0A0U1RQP7

Frequencies

GnomAD3 genomes AF: 0.000764 AC: 114 AN: 149146 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00136

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000466

Gnomad ASJ AF: 0.000294

Gnomad EAS AF: 0.00161

Gnomad SAS AF: 0.000874

Gnomad FIN AF: 0.000195

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000520

Gnomad OTH AF: 0.000983

GnomAD2 exomes AF: 0.000404 AC: 101 AN: 250234 AF XY: 0.000406

Gnomad AFR exome AF: 0.000680

Gnomad AMR exome AF: 0.000116

Gnomad ASJ exome AF: 0.000299

Gnomad EAS exome AF: 0.00126

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000433

Gnomad OTH exome AF: 0.000327

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000620 AC: 906 AN: 1461052 Hom.: 1 AF XY: 0.000608 AC XY: 442 AN XY: 726882

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00144 AC: 48 AN: 33430

American (AMR) AF: 0.000224 AC: 10 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.000804 AC: 21 AN: 26128

East Asian (EAS) AF: 0.00378 AC: 150 AN: 39680

South Asian (SAS) AF: 0.000395 AC: 34 AN: 86158

European-Finnish (FIN) AF: 0.0000938 AC: 5 AN: 53300

Middle Eastern (MID) AF: 0.000521 AC: 3 AN: 5756

European-Non Finnish (NFE) AF: 0.000544 AC: 605 AN: 1111528

Other (OTH) AF: 0.000497 AC: 30 AN: 60356

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000764 AC: 114 AN: 149240 Hom.: 0 Cov.: 31 AF XY: 0.000728 AC XY: 53 AN XY: 72768

African (AFR) AF: 0.00136 AC: 55 AN: 40528

American (AMR) AF: 0.000465 AC: 7 AN: 15052

Ashkenazi Jewish (ASJ) AF: 0.000294 AC: 1 AN: 3402

East Asian (EAS) AF: 0.00162 AC: 8 AN: 4948

South Asian (SAS) AF: 0.000877 AC: 4 AN: 4562

European-Finnish (FIN) AF: 0.000195 AC: 2 AN: 10254

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.000520 AC: 35 AN: 67244

Other (OTH) AF: 0.000973 AC: 2 AN: 2056

Alfa AF: 0.000218 Hom.: 111

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=180/20	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71170086; hg19: chr1-225707033;