1-225519331-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC

Variant names:

• chr1-225519331-A-ATCCAGGCGTTCCTGCCGCTCCAGGCGTTCCTGCCGC
• rs71170086
• NM_018212.6:c.633_668dupGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4 BS2

The NM_018212.6(ENAH):​c.633_668dupGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA​(p.Glu211_Leu222dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000869 in 1,610,334 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000087 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000087 (0 hom.)
• Consequence: ENAH NM_018212.6 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.04

Genes affected

ENAH (HGNC:18271): (ENAH actin regulator) This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_018212.6.
• BS2: High AC in GnomAd4 at 13 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ENAH	NM_018212.6	c.633_668dupGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222dup	disruptive_inframe_insertion	Exon 5 of 14	ENST00000366843.7	NP_060682.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ENAH	ENST00000366843.7	c.633_668dupGCGGCAGGAACGCCTGGAGCGGCAGGAACGCCTGGA	p.Glu211_Leu222dup	disruptive_inframe_insertion	Exon 5 of 14	1	NM_018212.6	ENSP00000355808.2

Frequencies

GnomAD3 genomes AF: 0.0000939 AC: 14 AN: 149150 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000200

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00141

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000595

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000759 AC: 19 AN: 250234 Hom.: 0 AF XY: 0.0000591 AC XY: 8 AN XY: 135350

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000766

Gnomad SAS exome AF: 0.0000983

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000177

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000869 AC: 127 AN: 1461090 Hom.: 0 Cov.: 30 AF XY: 0.0000867 AC XY: 63 AN XY: 726902

Gnomad4 AFR exome AF: 0.0000299

Gnomad4 AMR exome AF: 0.0000671

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00181

Gnomad4 SAS exome AF: 0.000139

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000270

Gnomad4 OTH exome AF: 0.000116

GnomAD4 genome AF: 0.0000871 AC: 13 AN: 149244 Hom.: 0 Cov.: 31 AF XY: 0.000110 AC XY: 8 AN XY: 72768

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.000199

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00121

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000595

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71170086; hg19: chr1-225707033;