1-23019614-GGCGGCAGCCGCGGCGGCGGCGGCTGCA-G

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3BP6_Very_StrongBS2

The NM_001009999.3(KDM1A):​c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC​(p.Ala10_Ala18del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000365 in 1,426,404 control chromosomes in the GnomAD database, including 4 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

Frequency

Genomes: 𝑓 0.00081 ( 1 hom., cov: 32)
Exomes 𝑓: 0.00031 ( 3 hom. )

Consequence

KDM1A
NM_001009999.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Benign criteria provided, multiple submitters, no conflicts B:2

Conservation

PhyloP100: 2.52

Publications

0 publications found
Variant links:
Genes affected
KDM1A (HGNC:29079): (lysine demethylase 1A) This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
KDM1A Gene-Disease associations (from GenCC):
  • palatal anomalies-widely spaced teeth-facial dysmorphism-developmental delay syndrome
    Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Benign. The variant received -13 ACMG points.

BP3
Nonframeshift variant in repetitive region in NM_001009999.3
BP6
Variant 1-23019614-GGCGGCAGCCGCGGCGGCGGCGGCTGCA-G is Benign according to our data. Variant chr1-23019614-GGCGGCAGCCGCGGCGGCGGCGGCTGCA-G is described in ClinVar as Benign. ClinVar VariationId is 1970962.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
BS2
High AC in GnomAd4 at 124 AD gene.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
KDM1ANM_001009999.3 linkc.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC p.Ala10_Ala18del disruptive_inframe_deletion Exon 1 of 21 ENST00000400181.9 NP_001009999.1 O60341-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
KDM1AENST00000400181.9 linkc.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC p.Ala10_Ala18del disruptive_inframe_deletion Exon 1 of 21 1 NM_001009999.3 ENSP00000383042.5 O60341-2

Frequencies

GnomAD3 genomes
AF:
0.000809
AC:
123
AN:
152090
Hom.:
1
Cov.:
32
show subpopulations
Gnomad AFR
AF:
0.000217
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00622
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.0000944
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.000177
Gnomad OTH
AF:
0.00287
GnomAD2 exomes
AF:
0.00105
AC:
76
AN:
72596
AF XY:
0.000733
show subpopulations
Gnomad AFR exome
AF:
0.00
Gnomad AMR exome
AF:
0.00738
Gnomad ASJ exome
AF:
0.00
Gnomad EAS exome
AF:
0.00
Gnomad FIN exome
AF:
0.00
Gnomad NFE exome
AF:
0.000137
Gnomad OTH exome
AF:
0.00198
GnomAD4 exome
AF:
0.000311
AC:
396
AN:
1274206
Hom.:
3
AF XY:
0.000303
AC XY:
190
AN XY:
627324
show subpopulations
African (AFR)
AF:
0.000195
AC:
5
AN:
25644
American (AMR)
AF:
0.00855
AC:
161
AN:
18838
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
19724
East Asian (EAS)
AF:
0.00
AC:
0
AN:
30004
South Asian (SAS)
AF:
0.0000492
AC:
3
AN:
61018
European-Finnish (FIN)
AF:
0.0000318
AC:
1
AN:
31442
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
3544
European-Non Finnish (NFE)
AF:
0.000195
AC:
201
AN:
1031834
Other (OTH)
AF:
0.000479
AC:
25
AN:
52158
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.468
Heterozygous variant carriers
0
18
35
53
70
88
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Exome Hom
Variant carriers
0
20
40
60
80
100
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
AF:
0.000815
AC:
124
AN:
152198
Hom.:
1
Cov.:
32
AF XY:
0.000806
AC XY:
60
AN XY:
74416
show subpopulations
African (AFR)
AF:
0.000217
AC:
9
AN:
41554
American (AMR)
AF:
0.00628
AC:
96
AN:
15290
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3472
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5164
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4828
European-Finnish (FIN)
AF:
0.0000944
AC:
1
AN:
10598
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
292
European-Non Finnish (NFE)
AF:
0.000177
AC:
12
AN:
67972
Other (OTH)
AF:
0.00284
AC:
6
AN:
2116
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.456
Heterozygous variant carriers
0
8
16
23
31
39
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
Alfa
AF:
0.000712
Hom.:
0
Bravo
AF:
0.00139
Asia WGS
AF:
0.000290
AC:
1
AN:
3460

ClinVar

Significance: Benign
Submissions summary: Benign:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

not provided Benign:2
Jun 01, 2025
CeGaT Center for Human Genetics Tuebingen
Significance:Benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

KDM1A: BS1, BS2 -

Feb 03, 2025
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.5
Mutation Taster
=199/1
polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs762119456; hg19: chr1-23346107; API