rs762119456

Variant names:

• chr1-23019614-GGCGGCAGCCGCGGCGGCGGCGGCTGCA-G
• rs762119456
• NM_001009999.3:c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_001009999.3(KDM1A):​c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC​(p.Ala10_Ala18del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000365 in 1,426,404 control chromosomes in the GnomAD database, including 4 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00081 (1 hom., cov: 32)
  • Exomes 𝑓: 0.00031 (3 hom.)
• Consequence: KDM1A NM_001009999.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 2.52
• Publications: 0 publications found

Genes affected

KDM1A (HGNC:29079): (lysine demethylase 1A) This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]

KDM1A Gene-Disease associations (from GenCC):

• palatal anomalies-widely spaced teeth-facial dysmorphism-developmental delay syndrome

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001009999.3
• BP6: Variant 1-23019614-GGCGGCAGCCGCGGCGGCGGCGGCTGCA-G is Benign according to our data. Variant chr1-23019614-GGCGGCAGCCGCGGCGGCGGCGGCTGCA-G is described in ClinVar as Benign. ClinVar VariationId is 1970962.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAd4 at 124 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001009999.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KDM1A	NM_001009999.3	MANE Select	c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC	p.Ala10_Ala18del	disruptive_inframe_deletion	Exon 1 of 21	NP_001009999.1	O60341-2
	KDM1A	NM_001410762.1		c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC	p.Ala10_Ala18del	disruptive_inframe_deletion	Exon 1 of 20	NP_001397691.1	A0A8I5KXU4
	KDM1A	NM_001363654.2		c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC	p.Ala10_Ala18del	disruptive_inframe_deletion	Exon 1 of 19	NP_001350583.1	R4GMQ1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KDM1A	ENST00000400181.9	TSL:1 MANE Select	c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC	p.Ala10_Ala18del	disruptive_inframe_deletion	Exon 1 of 21	ENSP00000383042.5	O60341-2
	KDM1A	ENST00000356634.7	TSL:1	c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC	p.Ala10_Ala18del	disruptive_inframe_deletion	Exon 1 of 19	ENSP00000349049.3	O60341-1
	KDM1A	ENST00000874661.1		c.27_53delCGCGGCGGCGGCGGCTGCAGCGGCAGC	p.Ala10_Ala18del	disruptive_inframe_deletion	Exon 1 of 21	ENSP00000544720.1

Frequencies

GnomAD3 genomes AF: 0.000809 AC: 123 AN: 152090 Hom.: 1 Cov.: 32

Gnomad AFR AF: 0.000217

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00622

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000944

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000177

Gnomad OTH AF: 0.00287

GnomAD2 exomes AF: 0.00105 AC: 76 AN: 72596 AF XY: 0.000733

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00738

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000137

Gnomad OTH exome AF: 0.00198

GnomAD4 exome AF: 0.000311 AC: 396 AN: 1274206 Hom.: 3 AF XY: 0.000303 AC XY: 190 AN XY: 627324

African (AFR) AF: 0.000195 AC: 5 AN: 25644

American (AMR) AF: 0.00855 AC: 161 AN: 18838

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19724

East Asian (EAS) AF: 0.00 AC: 0 AN: 30004

South Asian (SAS) AF: 0.0000492 AC: 3 AN: 61018

European-Finnish (FIN) AF: 0.0000318 AC: 1 AN: 31442

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3544

European-Non Finnish (NFE) AF: 0.000195 AC: 201 AN: 1031834

Other (OTH) AF: 0.000479 AC: 25 AN: 52158

GnomAD4 genome AF: 0.000815 AC: 124 AN: 152198 Hom.: 1 Cov.: 32 AF XY: 0.000806 AC XY: 60 AN XY: 74416

African (AFR) AF: 0.000217 AC: 9 AN: 41554

American (AMR) AF: 0.00628 AC: 96 AN: 15290

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5164

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.0000944 AC: 1 AN: 10598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.000177 AC: 12 AN: 67972

Other (OTH) AF: 0.00284 AC: 6 AN: 2116

Alfa AF: 0.000712 Hom.: 0

Bravo AF: 0.00139

Asia WGS AF: 0.000290 AC: 1 AN: 3460

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.5
Mutation Taster		=199/1	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs762119456; hg19: chr1-23346107;