1-234609347-CGACGCGGTCGGCGCCCTCGTAGTT-C

Variant names:

• chr1-234609347-CGACGCGGTCGGCGCCCTCGTAGTT-C
• NM_182972.3:c.124_147delAACTACGAGGGCGCCGACCGCGTC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_182972.3(IRF2BP2):​c.124_147delAACTACGAGGGCGCCGACCGCGTC​(p.Asn42_Val49del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. N42N) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 30)
• Consequence: IRF2BP2 NM_182972.3 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 5.03
• Publications: 0 publications found

Genes affected

IRF2BP2 (HGNC:21729): (interferon regulatory factor 2 binding protein 2) This gene encodes an interferon regulatory factor-2 (IRF2) binding protein that interacts with the C-terminal transcriptional repression domain of IRF2. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

LINC00184 (HGNC:37192): (long intergenic non-protein coding RNA 184)

ENSG00000228830 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_182972.3.
• PP5: Variant 1-234609347-CGACGCGGTCGGCGCCCTCGTAGTT-C is Pathogenic according to our data. Variant chr1-234609347-CGACGCGGTCGGCGCCCTCGTAGTT-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 2431683.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=1, Likely_pathogenic=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IRF2BP2	NM_182972.3	c.124_147delAACTACGAGGGCGCCGACCGCGTC	p.Asn42_Val49del	conservative_inframe_deletion	Exon 1 of 2	ENST00000366609.4	NP_892017.2
IRF2BP2	NM_001077397.1	c.124_147delAACTACGAGGGCGCCGACCGCGTC	p.Asn42_Val49del	conservative_inframe_deletion	Exon 1 of 2		NP_001070865.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IRF2BP2	ENST00000366609.4	c.124_147delAACTACGAGGGCGCCGACCGCGTC	p.Asn42_Val49del	conservative_inframe_deletion	Exon 1 of 2	1	NM_182972.3	ENSP00000355568.3
IRF2BP2	ENST00000366610.8	c.124_147delAACTACGAGGGCGCCGACCGCGTC	p.Asn42_Val49del	conservative_inframe_deletion	Exon 1 of 2	1		ENSP00000355569.3
LINC00184	ENST00000796406.1	n.59_82delGGTCGGCGCCCTCGTAGTTGACGC		non_coding_transcript_exon_variant	Exon 1 of 4
ENSG00000228830	ENST00000436039.1	n.631-68_631-45delGGTCGGCGCCCTCGTAGTTGACGC		intron_variant	Intron 1 of 1	3

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Immunodeficiency, common variable, 14 Pathogenic:1

Jul 05, 2022

Laboratorio de Genetica e Diagnostico Molecular, Hospital Israelita Albert Einstein

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

ACMG classification criteria: PM2 moderated, PM4, PM6 moderated -

not provided Uncertain:1

Jun 01, 2025

CeGaT Center for Human Genetics Tuebingen

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

IRF2BP2: PM2, PM4 -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr1-234745093;