1-235448371-G-GAAGGGATTGCTGTCACGTCTTCTCAAAGTTCCT

Position:

• chr1-235448371-G-GAAGGGATTGCTGTCACGTCTTCTCAAAGTTCCT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_003193.5(TBCE):​c.1423_1455dup​(p.Lys475_Pro485dup) variant causes a inframe insertion change. The variant allele was found at a frequency of 0.00000479 in 1,461,876 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000048 (0 hom.)
• Consequence: TBCE NM_003193.5 inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 6.46

Genes affected

TBCE (HGNC:11582): (tubulin folding cofactor E) Cofactor E is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

B3GALNT2 (HGNC:28596): (beta-1,3-N-acetylgalactosaminyltransferase 2) This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_003193.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
TBCE	NM_003193.5	c.1423_1455dup	p.Lys475_Pro485dup	inframe_insertion	16/17	ENST00000642610.2
B3GALNT2	NM_152490.5	c.*1834_*1835insAGGAACTTTGAGAAGACGTGACAGCAATCCCTT		3_prime_UTR_variant	12/12	ENST00000366600.8

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
TBCE	ENST00000642610.2	c.1423_1455dup	p.Lys475_Pro485dup	inframe_insertion	16/17		NM_003193.5	P1
B3GALNT2	ENST00000366600.8	c.*1834_*1835insAGGAACTTTGAGAAGACGTGACAGCAATCCCTT		3_prime_UTR_variant	12/12	1	NM_152490.5	P1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD3 exomes AF: 0.00000799 AC: 2 AN: 250444 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 135482

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000177

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000479 AC: 7 AN: 1461876 Hom.: 0 Cov.: 32 AF XY: 0.00000550 AC XY: 4 AN XY: 727238

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000629

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	GeneDx	Sep 20, 2022	Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of 11 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -
Uncertain significance, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Sep 01, 2022	This variant, c.1423_1455dup, results in the insertion of 11 amino acid(s) of the TBCE protein (p.Lys475_Pro485dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (no rsID available, gnomAD 0.002%). This variant has not been reported in the literature in individuals affected with TBCE-related conditions. ClinVar contains an entry for this variant (Variation ID: 1491529). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Inborn genetic diseases Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Oct 05, 2021

The c.1423_1455dupAAGGGATTGCTGTCACGTCTTCTCAAAGTTCCT (p.K475_P485dup) alteration is located in exon 16 (coding exon 15) of the TBCE gene. The alteration consists of an in-frame duplication of 33 nucleotides from position 1423 to 1455, resulting in the duplication of <NA> residues. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1478154983; hg19: chr1-235611686;