1-25800197-CCCGGGCCGCCGGCAGCCGCCGCCAGCCGCAGCCATGGG-C

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PS1_ModeratePP5_Moderate

The NM_020451.3(SELENON):​c.-26_12delGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 30)

Consequence

SELENON
NM_020451.3 frameshift, start_lost

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 0.881

Publications

0 publications found
Variant links:
Genes affected
SELENON (HGNC:15999): (selenoprotein N) This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in this gene are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. SEPN1-related myopathy consists of 4 autosomal recessive disorders, originally thought to be separate entities: rigid spine muscular dystrophy (RSMD1), the classical form of multiminicore disease, desmin related myopathy with Mallory-body like inclusions, and congenital fiber-type disproportion (CFTD). This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2016]
SELENON Gene-Disease associations (from GenCC):
  • rigid spine muscular dystrophy 1
    Inheritance: AR Classification: DEFINITIVE Submitted by: Ambry Genetics, G2P
  • SELENON-related myopathy
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • congenital myopathy 4A, autosomal dominant
    Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • congenital fiber-type disproportion myopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • desmin-related myopathy with Mallory body-like inclusions
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • rigid spine syndrome
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 88 pathogenic variants in the truncated region.
PS1
Another start lost variant in NM_020451.3 (SELENON) was described as [Likely_pathogenic] in ClinVar as 373075
PP5
Variant 1-25800197-CCCGGGCCGCCGGCAGCCGCCGCCAGCCGCAGCCATGGG-C is Pathogenic according to our data. Variant chr1-25800197-CCCGGGCCGCCGGCAGCCGCCGCCAGCCGCAGCCATGGG-C is described in ClinVar as [Pathogenic]. Clinvar id is 844164.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SELENONNM_020451.3 linkc.-26_12delGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCC p.Met1fs frameshift_variant, start_lost Exon 1 of 13 ENST00000361547.7 NP_065184.2 Q9NZV5-1
SELENONNM_020451.3 linkc.-26_12delGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCC 5_prime_UTR_variant Exon 1 of 13 ENST00000361547.7 NP_065184.2 Q9NZV5-1
SELENONNM_206926.2 linkc.-26_12delGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCC p.Met1fs frameshift_variant, start_lost Exon 1 of 12 NP_996809.1 Q9NZV5-2
SELENONNM_206926.2 linkc.-26_12delGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCC 5_prime_UTR_variant Exon 1 of 12 NP_996809.1 Q9NZV5-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SELENONENST00000361547.7 linkc.-26_12delGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCC p.Met1fs frameshift_variant, start_lost Exon 1 of 13 1 NM_020451.3 ENSP00000355141.2 Q9NZV5-1
SELENONENST00000361547.7 linkc.-26_12delGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCC 5_prime_UTR_variant Exon 1 of 13 1 NM_020451.3 ENSP00000355141.2 Q9NZV5-1

Frequencies

GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
30
Alfa
AF:
0.00
Hom.:
0
Bravo
AF:
0.00000378

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Eichsfeld type congenital muscular dystrophy Pathogenic:1
Jul 06, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Disruption of the initiator codon has been observed in individuals with SELENON-related conditions (PMID: 12192640, 16779558). This sequence change affects the initiator methionine of the SELENON mRNA. The next in-frame methionine is located at codon 85. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. ClinVar contains an entry for this variant (Variation ID: 844164). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.88

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs2047846279; hg19: chr1-26126688; API