1-25800211-AGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCCGCCGCT-A

Variant names:

• chr1-25800211-AGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCCGCCGCT-A
• NM_020451.3:c.-10_135del

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_020451.3(SELENON):​c.-10_135del​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 30)
• Consequence: SELENON NM_020451.3 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.792
• Publications: 0 publications found

Genes affected

SELENON (HGNC:15999): (selenoprotein N) This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in this gene are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. SEPN1-related myopathy consists of 4 autosomal recessive disorders, originally thought to be separate entities: rigid spine muscular dystrophy (RSMD1), the classical form of multiminicore disease, desmin related myopathy with Mallory-body like inclusions, and congenital fiber-type disproportion (CFTD). This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2016]

SELENON Gene-Disease associations (from GenCC):

• rigid spine muscular dystrophy 1

  Inheritance: AR Classification: DEFINITIVE Submitted by: Ambry Genetics, G2P
• SELENON-related myopathy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• congenital myopathy 4A, autosomal dominant

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• congenital fiber-type disproportion myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• desmin-related myopathy with Mallory body-like inclusions

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• rigid spine syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 92 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_020451.3 (SELENON) was described as [Likely_pathogenic] in ClinVar as 373075
• PP5: Variant 1-25800211-AGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCCGCCGCT-A is Pathogenic according to our data. Variant chr1-25800211-AGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCCGCCGCT-A is described in ClinVar as [Pathogenic]. Clinvar id is 2863453.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SELENON	NM_020451.3	c.-10_135del	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 13	ENST00000361547.7	NP_065184.2
SELENON	NM_020451.3	c.-10_135del		5_prime_UTR_variant	Exon 1 of 13	ENST00000361547.7	NP_065184.2
SELENON	NM_206926.2	c.-10_135del	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 12		NP_996809.1
SELENON	NM_206926.2	c.-10_135del		5_prime_UTR_variant	Exon 1 of 12		NP_996809.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SELENON	ENST00000361547.7	c.-10_135del	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 13	1	NM_020451.3	ENSP00000355141.2
SELENON	ENST00000361547.7	c.-10_135del		5_prime_UTR_variant	Exon 1 of 13	1	NM_020451.3	ENSP00000355141.2

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Eichsfeld type congenital muscular dystrophy Pathogenic:1

Dec 11, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change affects the initiator methionine of the SELENON mRNA. The next in-frame methionine is located at codon 85. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. Disruption of the initiator codon has been observed in individuals with clinical features of SELENON-related conditions (PMID: 12192640, 23394784, 28558865). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.79

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr1-26126702;