1-25800211-AGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCCGCCGCT-A
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1PS1_ModeratePP5_Moderate
The NM_020451.3(SELENON):c.-10_135del(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_020451.3 frameshift, start_lost
Scores
Clinical Significance
Conservation
Publications
- rigid spine muscular dystrophy 1Inheritance: AR Classification: DEFINITIVE Submitted by: Ambry Genetics, G2P
- SELENON-related myopathyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- congenital myopathy 4A, autosomal dominantInheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- congenital fiber-type disproportion myopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- desmin-related myopathy with Mallory body-like inclusionsInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- rigid spine syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SELENON | NM_020451.3 | c.-10_135del | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 13 | ENST00000361547.7 | NP_065184.2 | |
SELENON | NM_020451.3 | c.-10_135del | 5_prime_UTR_variant | Exon 1 of 13 | ENST00000361547.7 | NP_065184.2 | ||
SELENON | NM_206926.2 | c.-10_135del | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 12 | NP_996809.1 | ||
SELENON | NM_206926.2 | c.-10_135del | 5_prime_UTR_variant | Exon 1 of 12 | NP_996809.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SELENON | ENST00000361547.7 | c.-10_135del | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 13 | 1 | NM_020451.3 | ENSP00000355141.2 | ||
SELENON | ENST00000361547.7 | c.-10_135del | 5_prime_UTR_variant | Exon 1 of 13 | 1 | NM_020451.3 | ENSP00000355141.2 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 genome Cov.: 30
ClinVar
Submissions by phenotype
Eichsfeld type congenital muscular dystrophy Pathogenic:1
This sequence change affects the initiator methionine of the SELENON mRNA. The next in-frame methionine is located at codon 85. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. Disruption of the initiator codon has been observed in individuals with clinical features of SELENON-related conditions (PMID: 12192640, 23394784, 28558865). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at