1-26696421-C-CCCCGCCGCCGCCAGCAGCCTGGGCAA

Variant names:

• chr1-26696421-C-CCCCGCCGCCGCCAGCAGCCTGGGCAA
• rs797045262
• NM_006015.6:c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_006015.6(ARID1A):​c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC​(p.Pro20AlafsTer14) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000877 in 1,139,708 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 8.8e-7 (0 hom.)
• Consequence: ARID1A NM_006015.6 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.25
• Publications: 0 publications found

Genes affected

ARID1A (HGNC:11110): (AT-rich interaction domain 1A) This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ARID1A Gene-Disease associations (from GenCC):

• Coffin-Siris syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• intellectual disability, autosomal dominant 14

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Illumina, G2P, Labcorp Genetics (formerly Invitae)

LOC124900417 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 130 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006015.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARID1A	NM_006015.6	MANE Select	c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift	Exon 1 of 20	NP_006006.3
	ARID1A	NM_139135.4		c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift	Exon 1 of 20	NP_624361.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARID1A	ENST00000324856.13	TSL:1 MANE Select	c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift	Exon 1 of 20	ENSP00000320485.7
	ARID1A	ENST00000850904.1		c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift	Exon 1 of 20	ENSP00000520984.1
	ARID1A	ENST00000457599.7	TSL:5	c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift	Exon 1 of 20	ENSP00000387636.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 8.77e-7 AC: 1 AN: 1139708 Hom.: 0 Cov.: 35 AF XY: 0.00000181 AC XY: 1 AN XY: 553360

African (AFR) AF: 0.00 AC: 0 AN: 23054

American (AMR) AF: 0.00 AC: 0 AN: 11292

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 15664

East Asian (EAS) AF: 0.00 AC: 0 AN: 25828

South Asian (SAS) AF: 0.00 AC: 0 AN: 38824

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 23944

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3056

European-Non Finnish (NFE) AF: 0.00000105 AC: 1 AN: 952858

Other (OTH) AF: 0.00 AC: 0 AN: 45188

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797045262; hg19: chr1-27022912;