1-26696421-CCCCGCCGCCGCCAGCAGCCTGGGCAA-CCCCGCCGCCGCCAGCAGCCTGGGCAACCCGCCGCCGCCAGCAGCCTGGGCAA

Variant names:

• chr1-26696421-C-CCCCGCCGCCGCCAGCAGCCTGGGCAA
• NM_006015.6:c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_006015.6(ARID1A):​c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC​(p.Pro20AlafsTer14) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000877 in 1,139,708 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 8.8e-7 (0 hom.)
• Consequence: ARID1A NM_006015.6 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.25

Genes affected

ARID1A (HGNC:11110): (AT-rich interaction domain 1A) This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

LOC124900417 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 114 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ARID1A	NM_006015.6	c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift_variant	Exon 1 of 20	ENST00000324856.13	NP_006006.3
ARID1A	NM_139135.4	c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift_variant	Exon 1 of 20		NP_624361.1
LOC124900417	XM_047439473.1	c.-42_-17dupTTGCCCAGGCTGCTGGCGGCGGCGGG		upstream_gene_variant			XP_047295429.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ARID1A	ENST00000324856.13	c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift_variant	Exon 1 of 20	1	NM_006015.6	ENSP00000320485.7
ARID1A	ENST00000457599.6	c.31_56dupAGCAGCCTGGGCAACCCGCCGCCGCC	p.Pro20AlafsTer14	frameshift_variant	Exon 1 of 20	5		ENSP00000387636.2
ARID1A	ENST00000430799.7	c.-13+2817_-13+2842dupAGCAGCCTGGGCAACCCGCCGCCGCC		intron_variant	Intron 1 of 19	5		ENSP00000390317.3
ARID1A	ENST00000637465.1	c.-13+334_-13+359dupAGCAGCCTGGGCAACCCGCCGCCGCC		intron_variant	Intron 1 of 2	5		ENSP00000490650.1

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 8.77e-7 AC: 1 AN: 1139708 Hom.: 0 Cov.: 35 AF XY: 0.00000181 AC XY: 1 AN XY: 553360

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000105

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-27022912;