1-26951494-C-CGGCCCTCAGCATCCTGCTCATCCAGGT

Variant names:

• chr1-26951494-C-CGGCCCTCAGCATCCTGCTCATCCAGGT
• NM_152365.3:c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_152365.3(KDF1):​c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC​(p.His287_Gly295dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KDF1 NM_152365.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.62
• Publications: 0 publications found

Genes affected

KDF1 (HGNC:26624): (keratinocyte differentiation factor 1) Predicted to be involved in several processes, including positive regulation of epidermal cell differentiation; regulation of epidermal cell division; and skin development. Predicted to act upstream of or within keratinocyte development and negative regulation of keratinocyte proliferation. Located in cell junction; mitotic spindle; and nucleoplasm. Implicated in ectodermal dysplasia 12. [provided by Alliance of Genome Resources, Apr 2022]

KDF1 Gene-Disease associations (from GenCC):

• ectodermal dysplasia 12, hypohidrotic/hair/tooth/nail type

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen
• autosomal dominant hypohidrotic ectodermal dysplasia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_152365.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152365.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KDF1	NM_152365.3	MANE Select	c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	Exon 2 of 4	NP_689578.2	Q8NAX2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KDF1	ENST00000320567.6	TSL:2 MANE Select	c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	Exon 2 of 4	ENSP00000319179.5	Q8NAX2
	KDF1	ENST00000866899.1		c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	Exon 2 of 4	ENSP00000536958.1
	KDF1	ENST00000866900.1		c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	Exon 3 of 5	ENSP00000536959.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr1-27277985;