chr1-26951494-C-CGGCCCTCAGCATCCTGCTCATCCAGGT

Position:

• chr1-26951494-C-CGGCCCTCAGCATCCTGCTCATCCAGGT

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_152365.3(KDF1):​c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC​(p.His287_Gly295dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: KDF1 NM_152365.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.62

Genes affected

KDF1 (HGNC:26624): (keratinocyte differentiation factor 1) Predicted to be involved in several processes, including positive regulation of epidermal cell differentiation; regulation of epidermal cell division; and skin development. Predicted to act upstream of or within keratinocyte development and negative regulation of keratinocyte proliferation. Located in cell junction; mitotic spindle; and nucleoplasm. Implicated in ectodermal dysplasia 12. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_152365.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
KDF1	NM_152365.3	c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	2/4	ENST00000320567.6	NP_689578.2
KDF1	XM_005245735.3	c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	2/4		XP_005245792.1
KDF1	XM_011540622.3	c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	2/4		XP_011538924.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
KDF1	ENST00000320567.6	c.860_886dupACCTGGATGAGCAGGATGCTGAGGGCC	p.His287_Gly295dup	conservative_inframe_insertion	2/4	2	NM_152365.3	ENSP00000319179.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 19, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant has not been reported in the literature in individuals affected with KDF1-related conditions. This variant, c.860_886dup, results in the insertion of 9 amino acid(s) of the KDF1 protein (p.His287_Gly295dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-27277985;