1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-G
Variant summary
Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_StrongBA1
The NM_022114.4(PRDM16):c.884+39_884+69delACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00502 in 1,590,522 control chromosomes in the GnomAD database, including 280 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).
Frequency
Consequence
NM_022114.4 intron
Scores
Clinical Significance
Conservation
Publications
- dilated cardiomyopathyInheritance: AD Classification: STRONG Submitted by: ClinGen
- left ventricular noncompaction 8Inheritance: AD Classification: MODERATE, LIMITED Submitted by: Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- left ventricular noncompactionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_022114.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PRDM16 | TSL:1 MANE Select | c.884+9_884+39delCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA | intron | N/A | ENSP00000270722.5 | Q9HAZ2-1 | |||
| PRDM16 | TSL:1 | c.884+9_884+39delCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA | intron | N/A | ENSP00000367643.2 | Q9HAZ2-2 | |||
| PRDM16 | TSL:1 | n.662+9_662+39delCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.0255 AC: 3682AN: 144354Hom.: 131 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00508 AC: 1230AN: 242072 AF XY: 0.00394 show subpopulations
GnomAD4 exome AF: 0.00296 AC: 4286AN: 1446052Hom.: 147 AF XY: 0.00266 AC XY: 1912AN XY: 718496 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0255 AC: 3691AN: 144470Hom.: 133 Cov.: 32 AF XY: 0.0249 AC XY: 1763AN XY: 70708 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at