rs765185537

Variant names:

• chr1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-G
• rs765185537
• NM_022114.4:c.884+39_884+69delACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT

Your query was ambiguous. Multiple possible variants found:

• chr1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-G
• chr1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTACCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_022114.4(PRDM16):​c.884+39_884+69delACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00502 in 1,590,522 control chromosomes in the GnomAD database, including 280 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.026 (133 hom., cov: 32)
  • Exomes 𝑓: 0.0030 (147 hom.)
• Consequence: PRDM16 NM_022114.4 intron
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 2.87
• Publications: 0 publications found

Genes affected

PRDM16 (HGNC:14000): (PR/SET domain 16) The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

PRDM16 Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: STRONG Submitted by: ClinGen
• left ventricular noncompaction 8

  Inheritance: AD Classification: MODERATE, LIMITED Submitted by: Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• left ventricular noncompaction

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-G is Benign according to our data. Variant chr1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-G is described in ClinVar as Benign. ClinVar VariationId is 406244.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0901 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_022114.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRDM16	NM_022114.4	MANE Select	c.884+39_884+69delACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT		intron	N/A	NP_071397.3
	PRDM16	NM_199454.3		c.884+39_884+69delACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT		intron	N/A	NP_955533.2	Q9HAZ2-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRDM16	ENST00000270722.10	TSL:1 MANE Select	c.884+9_884+39delCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA		intron	N/A	ENSP00000270722.5	Q9HAZ2-1
	PRDM16	ENST00000378391.6	TSL:1	c.884+9_884+39delCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA		intron	N/A	ENSP00000367643.2	Q9HAZ2-2
	PRDM16	ENST00000512462.5	TSL:1	n.662+9_662+39delCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.0255 AC: 3682 AN: 144354 Hom.: 131 Cov.: 32

Gnomad AFR AF: 0.0928

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0133

Gnomad ASJ AF: 0.00349

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000654

Gnomad FIN AF: 0.000194

Gnomad MID AF: 0.00974

Gnomad NFE AF: 0.000946

Gnomad OTH AF: 0.0194

GnomAD2 exomes AF: 0.00508 AC: 1230 AN: 242072 AF XY: 0.00394

Gnomad AFR exome AF: 0.0639

Gnomad AMR exome AF: 0.00470

Gnomad ASJ exome AF: 0.00233

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.000140

Gnomad NFE exome AF: 0.000915

Gnomad OTH exome AF: 0.00505

GnomAD4 exome AF: 0.00296 AC: 4286 AN: 1446052 Hom.: 147 AF XY: 0.00266 AC XY: 1912 AN XY: 718496

African (AFR) AF: 0.0834 AC: 2660 AN: 31900

American (AMR) AF: 0.00713 AC: 317 AN: 44466

Ashkenazi Jewish (ASJ) AF: 0.00269 AC: 70 AN: 26008

East Asian (EAS) AF: 0.00 AC: 0 AN: 39374

South Asian (SAS) AF: 0.000503 AC: 43 AN: 85534

European-Finnish (FIN) AF: 0.000193 AC: 10 AN: 51742

Middle Eastern (MID) AF: 0.00949 AC: 44 AN: 4638

European-Non Finnish (NFE) AF: 0.000669 AC: 738 AN: 1102896

Other (OTH) AF: 0.00679 AC: 404 AN: 59494

GnomAD4 genome AF: 0.0255 AC: 3691 AN: 144470 Hom.: 133 Cov.: 32 AF XY: 0.0249 AC XY: 1763 AN XY: 70708

African (AFR) AF: 0.0927 AC: 3372 AN: 36362

American (AMR) AF: 0.0133 AC: 197 AN: 14858

Ashkenazi Jewish (ASJ) AF: 0.00349 AC: 12 AN: 3442

East Asian (EAS) AF: 0.00 AC: 0 AN: 5084

South Asian (SAS) AF: 0.000654 AC: 3 AN: 4586

European-Finnish (FIN) AF: 0.000194 AC: 2 AN: 10328

Middle Eastern (MID) AF: 0.0105 AC: 3 AN: 286

European-Non Finnish (NFE) AF: 0.000946 AC: 63 AN: 66578

Other (OTH) AF: 0.0192 AC: 39 AN: 2034

Alfa AF: 0.0113 Hom.: 4

Asia WGS AF: 0.00433 AC: 15 AN: 3478

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Left ventricular noncompaction 8 (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.9
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs765185537; hg19: chr1-3319570;