1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTACCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA

Position:

• chr1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTACCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_022114.4(PRDM16):​c.884+39_884+69dupACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000138 in 144,520 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000014 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0000048 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PRDM16 NM_022114.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.373

Genes affected

PRDM16 (HGNC:14000): (PR/SET domain 16) The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PRDM16	NM_022114.4	c.884+39_884+69dupACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT		intron_variant		ENST00000270722.10	NP_071397.3
PRDM16	NM_199454.3	c.884+39_884+69dupACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT		intron_variant			NP_955533.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PRDM16	ENST00000270722.10	c.884+8_884+9insCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA		intron_variant		1	NM_022114.4	ENSP00000270722.5

Frequencies

GnomAD3 genomes AF: 0.0000138 AC: 2 AN: 144406 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000393

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000484 AC: 7 AN: 1446188 Hom.: 0 Cov.: 31 AF XY: 0.00000557 AC XY: 4 AN XY: 718546

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000152

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.07e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000138 AC: 2 AN: 144520 Hom.: 0 Cov.: 33 AF XY: 0.0000141 AC XY: 1 AN XY: 70734

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000393

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs765185537; hg19: chr1-3319570;