1-3403006-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA-GCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTACCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_022114.4(PRDM16):c.884+39_884+69dupACCCTCCTCTGAGTCTTCCTCCCCTTCCCGT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000138 in 144,520 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_022114.4 intron
Scores
Clinical Significance
Conservation
Publications
- dilated cardiomyopathyInheritance: AD Classification: STRONG Submitted by: ClinGen
- left ventricular noncompaction 8Inheritance: AD Classification: MODERATE, LIMITED Submitted by: Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- left ventricular noncompactionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_022114.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PRDM16 | TSL:1 MANE Select | c.884+8_884+9insCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA | intron | N/A | ENSP00000270722.5 | Q9HAZ2-1 | |||
| PRDM16 | TSL:1 | c.884+8_884+9insCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA | intron | N/A | ENSP00000367643.2 | Q9HAZ2-2 | |||
| PRDM16 | TSL:1 | n.662+8_662+9insCCCTCCTCTGAGTCTTCCTCCCCTTCCCGTA | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.0000138 AC: 2AN: 144406Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000484 AC: 7AN: 1446188Hom.: 0 Cov.: 31 AF XY: 0.00000557 AC XY: 4AN XY: 718546 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000138 AC: 2AN: 144520Hom.: 0 Cov.: 33 AF XY: 0.0000141 AC XY: 1AN XY: 70734 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at