1-54999142-C-CCCCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAG

Variant names:

• chr1-54999142-C-CCCCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAG
• NM_057176.3:c.-42_-1dupCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PS1_Moderate

The NM_057176.3(BSND):​c.-42_-1dupCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAGCC variant causes a start lost, conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: BSND NM_057176.3 start_lost, conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.494
• Publications: 0 publications found

Genes affected

BSND (HGNC:16512): (barttin CLCNK type accessory subunit beta) This gene encodes an essential beta subunit for CLC chloride channels. These heteromeric channels localize to basolateral membranes of renal tubules and of potassium-secreting epithelia of the inner ear. Mutations in this gene have been associated with Bartter syndrome with sensorineural deafness. [provided by RefSeq, Jul 2008]

BSND Gene-Disease associations (from GenCC):

• Bartter disease type 4A

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P
• Bartter syndrome type 4

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_057176.3 (BSND) was described as [Likely_pathogenic] in ClinVar

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_057176.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BSND	NM_057176.3	MANE Select	c.-42_-1dupCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAGCC		start_lost conservative_inframe_insertion	Exon 1 of 4	NP_476517.1	Q8WZ55

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BSND	ENST00000651561.1	MANE Select	c.-42_-1dupCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAGCC		start_lost conservative_inframe_insertion	Exon 1 of 4	ENSP00000498282.1	Q8WZ55

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.49

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr1-55464815;