chr1-54999142-C-CCCCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAG
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PS1_Moderate
The NM_057176.3(BSND):c.-42_-1dupCCTCTCCCGGGGGTGTGCAGGCCAGGGACTGGCCAGGCAGCC variant causes a start lost, conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_057176.3 start_lost, conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Bartter disease type 4AInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P
- Bartter syndrome type 4Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_057176.3. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at