1-99874614-A-ATTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTT

Variant names:

• chr1-99874614-A-ATTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTT
• rs1553185268
• NM_000642.3:c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000642.3(AGL):​c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG​(p.Arg322fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R322R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: AGL NM_000642.3 frameshift, stop_gained
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.361
• Publications: 0 publications found

Genes affected

AGL (HGNC:321): (amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase) This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

AGL Gene-Disease associations (from GenCC):

• glycogen storage disease III

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Ambry Genetics, Laboratory for Molecular Medicine, Myriad Women’s Health, Orphanet, G2P, PanelApp Australia, Labcorp Genetics (formerly Invitae), Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-99874614-A-ATTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTT is Pathogenic according to our data. Variant chr1-99874614-A-ATTAGAAAATAGTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTT is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 1691429.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AGL	NM_000642.3	c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift_variant, stop_gained	Exon 8 of 34	ENST00000361915.8	NP_000633.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AGL	ENST00000361915.8	c.959-61_965dupTGACAGTTATAATCTCTTTGTAGATATTTGCATTTAAGGTATCGTCTTTTCTTTCTTTTAGAAAATAG	p.Arg322fs	frameshift_variant, stop_gained	Exon 8 of 34	1	NM_000642.3	ENSP00000355106.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 19

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Jun 10, 2021

Mayo Clinic Laboratories, Mayo Clinic

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PVS1, PM2 -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.36

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553185268; hg19: chr1-100340170;