10-43077260-T-TGGCGAAGGCGACGTCCGGTGCCGC

Variant names:

• chr10-43077260-T-TGGCGAAGGCGACGTCCGGTGCCGC
• rs1837063549
• NM_020975.6:c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_020975.6(RET):​c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG​(p.Ala2_Ala9dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 35)
  • Exomes 𝑓: 0.0000022 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: RET NM_020975.6 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 3.33

Genes affected

RET (HGNC:9967): (ret proto-oncogene) This gene encodes a transmembrane receptor and member of the tyrosine protein kinase family of proteins. Binding of ligands such as GDNF (glial cell-line derived neurotrophic factor) and other related proteins to the encoded receptor stimulates receptor dimerization and activation of downstream signaling pathways that play a role in cell differentiation, growth, migration and survival. The encoded receptor is important in development of the nervous system, and the development of organs and tissues derived from the neural crest. This proto-oncogene can undergo oncogenic activation through both cytogenetic rearrangement and activating point mutations. Mutations in this gene are associated with Hirschsprung disease and central hypoventilation syndrome and have been identified in patients with renal agenesis. [provided by RefSeq, Sep 2017]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_020975.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RET	NM_020975.6	c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 20	ENST00000355710.8	NP_066124.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RET	ENST00000355710.8	c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 20	5	NM_020975.6	ENSP00000347942.3

Frequencies

GnomAD3 genomes Cov.: 35

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000222 AC: 3 AN: 1351954 Hom.: 0 Cov.: 30 AF XY: 0.00000300 AC XY: 2 AN XY: 666780

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000395

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 35

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Mar 04, 2025

Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Multiple endocrine neoplasia, type 2 Uncertain:1

Aug 31, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.5_28dup, results in the insertion of 8 amino acid(s) of the RET protein (p.Ala2_Ala9dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RET-related conditions. ClinVar contains an entry for this variant (Variation ID: 1020843). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Jun 05, 2024

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.5_28dup24 variant (also known as p.A2_A9dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 24 nucleotides at nucleotide positions 5 to 28. This results in the duplication of 8 extra residues (AKATSGAA) between codons 2 and 9. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1837063549; hg19: chr10-43572708;