10-43077260-T-TGGCGAAGGCGACGTCCGGTGCCGC

Variant names:

• chr10-43077260-T-TGGCGAAGGCGACGTCCGGTGCCGC
• rs1837063549
• NM_020975.6:c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_020975.6(RET):​c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG​(p.Ala2_Ala9dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. G10G) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 35)
  • Exomes 𝑓: 0.0000022 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: RET NM_020975.6 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 3.33
• Publications: 0 publications found

Genes affected

RET (HGNC:9967): (ret proto-oncogene) This gene encodes a transmembrane receptor and member of the tyrosine protein kinase family of proteins. Binding of ligands such as GDNF (glial cell-line derived neurotrophic factor) and other related proteins to the encoded receptor stimulates receptor dimerization and activation of downstream signaling pathways that play a role in cell differentiation, growth, migration and survival. The encoded receptor is important in development of the nervous system, and the development of organs and tissues derived from the neural crest. This proto-oncogene can undergo oncogenic activation through both cytogenetic rearrangement and activating point mutations. Mutations in this gene are associated with Hirschsprung disease and central hypoventilation syndrome and have been identified in patients with renal agenesis. [provided by RefSeq, Sep 2017]

RET Gene-Disease associations (from GenCC):

• familial medullary thyroid carcinoma

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• multiple endocrine neoplasia type 2A

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
• multiple endocrine neoplasia type 2B

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), G2P, ClinGen
• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• Hirschsprung disease, susceptibility to, 1

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• Haddad syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Hirschsprung disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• renal agenesis, unilateral

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• bilateral renal agenesis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• renal agenesis

  Inheritance: AR Classification: LIMITED Submitted by: G2P

ENSG00000303432 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_020975.6.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020975.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RET	NM_020975.6	MANE Select	c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 20	NP_066124.1	P07949-1
	RET	NM_001406743.1		c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 21	NP_001393672.1	P07949-1
	RET	NM_001406744.1		c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 20	NP_001393673.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RET	ENST00000355710.8	TSL:5 MANE Select	c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 20	ENSP00000347942.3	P07949-1
	RET	ENST00000340058.6	TSL:1	c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 19	ENSP00000344798.4	P07949-2
	RET	ENST00000713926.1		c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG	p.Ala2_Ala9dup	disruptive_inframe_insertion	Exon 1 of 19	ENSP00000519223.1	A0AAQ5BH28

Frequencies

GnomAD3 genomes Cov.: 35

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000222 AC: 3 AN: 1351954 Hom.: 0 Cov.: 30 AF XY: 0.00000300 AC XY: 2 AN XY: 666780

African (AFR) AF: 0.00 AC: 0 AN: 28098

American (AMR) AF: 0.00 AC: 0 AN: 32704

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24184

East Asian (EAS) AF: 0.00 AC: 0 AN: 32546

South Asian (SAS) AF: 0.0000395 AC: 3 AN: 76006

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 33198

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4790

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1064028

Other (OTH) AF: 0.00 AC: 0 AN: 56400

GnomAD4 genome Cov.: 35

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	Multiple endocrine neoplasia, type 2 (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1837063549; hg19: chr10-43572708;