NM_020975.6:c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_020975.6(RET):c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG(p.Ala2_Ala9dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_020975.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RET | NM_020975.6 | c.5_28dupCGAAGGCGACGTCCGGTGCCGCGG | p.Ala2_Ala9dup | disruptive_inframe_insertion | Exon 1 of 20 | ENST00000355710.8 | NP_066124.1 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 35
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000222 AC: 3AN: 1351954Hom.: 0 Cov.: 30 AF XY: 0.00000300 AC XY: 2AN XY: 666780
GnomAD4 genome Cov.: 35
ClinVar
Submissions by phenotype
not specified Uncertain:1
- -
Multiple endocrine neoplasia, type 2 Uncertain:1
This variant, c.5_28dup, results in the insertion of 8 amino acid(s) of the RET protein (p.Ala2_Ala9dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RET-related conditions. ClinVar contains an entry for this variant (Variation ID: 1020843). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.5_28dup24 variant (also known as p.A2_A9dup), located in coding exon 1 of the RET gene, results from an in-frame duplication of 24 nucleotides at nucleotide positions 5 to 28. This results in the duplication of 8 extra residues (AKATSGAA) between codons 2 and 9. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at