10-72005899-G-GATGAGAAGCAAATACGCCCT

Position:

• chr10-72005899-G-GATGAGAAGCAAATACGCCCT

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_004273.5(CHST3):​c.58_77dupATGAGAAGCAAATACGCCCT​(p.Phe27fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CHST3 NM_004273.5 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.70

Genes affected

CHST3 (HGNC:1971): (carbohydrate sulfotransferase 3) This gene encodes an enzyme which catalyzes the sulfation of chondroitin, a proteoglycan found in the extracellular matrix and most cells which is involved in cell migration and differentiation. Mutations in this gene are associated with spondylepiphyseal dysplasia and humerospinal dysostosis. [provided by RefSeq, Mar 2009]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 4 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 10-72005899-G-GATGAGAAGCAAATACGCCCT is Pathogenic according to our data. Variant chr10-72005899-G-GATGAGAAGCAAATACGCCCT is described in ClinVar as [Pathogenic]. Clinvar id is 1996399.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CHST3	NM_004273.5	c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift_variant, stop_gained	2/3	ENST00000373115.5	NP_004264.2
CHST3	XM_006718075.5	c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift_variant, stop_gained	2/3		XP_006718138.1
CHST3	XM_011540369.3	c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift_variant, stop_gained	2/3		XP_011538671.1
CHST3	XM_047426022.1	c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift_variant, stop_gained	2/3		XP_047281978.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CHST3	ENST00000373115.5	c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift_variant, stop_gained	2/3	1	NM_004273.5	ENSP00000362207.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Spondyloepiphyseal dysplasia with congenital joint dislocations Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 19, 2022

This sequence change creates a premature translational stop signal (p.Phe27*) in the CHST3 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CHST3 are known to be pathogenic (PMID: 18513679, 20830804, 24300290). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CHST3-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1240422084; hg19: chr10-73765657;