rs1240422084

Variant names:

• chr10-72005899-G-GATGAGAAGCAAATACGCCCT
• rs1240422084
• NM_004273.5:c.58_77dupATGAGAAGCAAATACGCCCT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004273.5(CHST3):​c.58_77dupATGAGAAGCAAATACGCCCT​(p.Phe27fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: CHST3 NM_004273.5 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.70
• Publications: 0 publications found

Genes affected

CHST3 (HGNC:1971): (carbohydrate sulfotransferase 3) This gene encodes an enzyme which catalyzes the sulfation of chondroitin, a proteoglycan found in the extracellular matrix and most cells which is involved in cell migration and differentiation. Mutations in this gene are associated with spondylepiphyseal dysplasia and humerospinal dysostosis. [provided by RefSeq, Mar 2009]

CHST3 Gene-Disease associations (from GenCC):

• spondyloepiphyseal dysplasia with congenital joint dislocations

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, ClinGen, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 56 pathogenic variants in the truncated region.
• PP5: Variant 10-72005899-G-GATGAGAAGCAAATACGCCCT is Pathogenic according to our data. Variant chr10-72005899-G-GATGAGAAGCAAATACGCCCT is described in ClinVar as Pathogenic. ClinVar VariationId is 1996399.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004273.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHST3	NM_004273.5	MANE Select	c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift stop_gained	Exon 2 of 3	NP_004264.2
	CHST3	NM_001441201.1		c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift stop_gained	Exon 2 of 3	NP_001428130.1
	CHST3	NM_001441202.1		c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift stop_gained	Exon 2 of 3	NP_001428131.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHST3	ENST00000373115.5	TSL:1 MANE Select	c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift stop_gained	Exon 2 of 3	ENSP00000362207.4	Q7LGC8
	CHST3	ENST00000879006.1		c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift stop_gained	Exon 2 of 3	ENSP00000549065.1
	CHST3	ENST00000943244.1		c.58_77dupATGAGAAGCAAATACGCCCT	p.Phe27fs	frameshift stop_gained	Exon 2 of 3	ENSP00000613303.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Spondyloepiphyseal dysplasia with congenital joint dislocations (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.7
Mutation Taster		=14/186	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1240422084; hg19: chr10-73765657;