10-77637588-CGCCGCCGCCGCCGCCGCCGCTGCT-C

Variant names:

• chr10-77637588-CGCCGCCGCCGCCGCCGCCGCTGCT-C
• rs587780364
• NM_001161352.2:c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001161352.2(KCNMA1):​c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC​(p.Ser11_Gly18del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.0000587 in 1,464,548 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000053 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000059 (0 hom.)
• Consequence: KCNMA1 NM_001161352.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 4.78
• Publications: 0 publications found

Genes affected

KCNMA1 (HGNC:6284): (potassium calcium-activated channel subfamily M alpha 1) This gene encodes the alpha subunit of calcium-activated BK channel. The encoded protein is involved in several physiological processes including smooth muscle contraction, neurotransmitter release and neuronal excitability. Mutations in this gene are associated with a spectrum of neurological disorders including Paroxysmal Nonkinesigenic Dyskinesia 3, Idiopathic Generalized Epilepsy 16 and Liang-Wang syndrome. [provided by RefSeq, Aug 2022]

KCNMA1 Gene-Disease associations (from GenCC):

• generalized epilepsy-paroxysmal dyskinesia syndrome

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet, Illumina
• Liang-Wang syndrome

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics
• cerebellar atrophy, developmental delay, and seizures

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001161352.2

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001161352.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNMA1	NM_001161352.2	MANE Select	c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC	p.Ser11_Gly18del	conservative_inframe_deletion	Exon 1 of 28	NP_001154824.1	Q12791-1
	KCNMA1	NM_001437422.1		c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC	p.Ser11_Gly18del	conservative_inframe_deletion	Exon 1 of 28	NP_001424351.1
	KCNMA1	NM_001161353.2		c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC	p.Ser11_Gly18del	conservative_inframe_deletion	Exon 1 of 28	NP_001154825.1	Q12791-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNMA1	ENST00000286628.14	TSL:1 MANE Select	c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC	p.Ser11_Gly18del	conservative_inframe_deletion	Exon 1 of 28	ENSP00000286628.8	Q12791-1
	KCNMA1	ENST00000626620.3	TSL:1	c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC	p.Ser11_Gly18del	conservative_inframe_deletion	Exon 1 of 28	ENSP00000485867.1	Q12791-2
	KCNMA1	ENST00000639406.1	TSL:1	c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC	p.Ser11_Gly18del	conservative_inframe_deletion	Exon 1 of 29	ENSP00000491732.1	B7ZMF5

Frequencies

GnomAD3 genomes AF: 0.0000528 AC: 8 AN: 151490 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000394

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000295

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000144 AC: 16 AN: 111174 AF XY: 0.0000982

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000538

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000705

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000594 AC: 78 AN: 1313058 Hom.: 0 AF XY: 0.0000556 AC XY: 36 AN XY: 647696

African (AFR) AF: 0.0000345 AC: 1 AN: 28948

American (AMR) AF: 0.000384 AC: 12 AN: 31232

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23220

East Asian (EAS) AF: 0.0000298 AC: 1 AN: 33566

South Asian (SAS) AF: 0.000110 AC: 8 AN: 72776

European-Finnish (FIN) AF: 0.0000291 AC: 1 AN: 34368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4910

European-Non Finnish (NFE) AF: 0.0000496 AC: 51 AN: 1029134

Other (OTH) AF: 0.0000729 AC: 4 AN: 54904

GnomAD4 genome AF: 0.0000528 AC: 8 AN: 151490 Hom.: 0 Cov.: 32 AF XY: 0.0000676 AC XY: 5 AN XY: 73950

African (AFR) AF: 0.00 AC: 0 AN: 41248

American (AMR) AF: 0.000394 AC: 6 AN: 15230

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3462

East Asian (EAS) AF: 0.00 AC: 0 AN: 5112

South Asian (SAS) AF: 0.00 AC: 0 AN: 4798

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10538

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.0000295 AC: 2 AN: 67794

Other (OTH) AF: 0.00 AC: 0 AN: 2088

Alfa AF: 0.000162 Hom.: 0

Bravo AF: 0.0000945

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	not provided (2)
-	1	-	Generalized epilepsy-paroxysmal dyskinesia syndrome (1)
-	1	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=140/60	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587780364; hg19: chr10-79397346;