Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.
The NM_001161352.2(KCNMA1):c.31_54delAGCAGCGGCGGCGGCGGCGGCGGC(p.Ser11_Gly18del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.0000587 in 1,464,548 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
KCNMA1 (HGNC:6284): (potassium calcium-activated channel subfamily M alpha 1) This gene encodes the alpha subunit of calcium-activated BK channel. The encoded protein is involved in several physiological processes including smooth muscle contraction, neurotransmitter release and neuronal excitability. Mutations in this gene are associated with a spectrum of neurological disorders including Paroxysmal Nonkinesigenic Dyskinesia 3, Idiopathic Generalized Epilepsy 16 and Liang-Wang syndrome. [provided by RefSeq, Aug 2022]
Review Status: criteria provided, single submitter
Collection Method: clinical testing
In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports that this variant does not alter protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -
Oct 02, 2013
Genetic Services Laboratory, University of Chicago
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This variant, c.31_54del, results in the deletion of 8 amino acid(s) of the KCNMA1 protein (p.Ser11_Gly18del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with KCNMA1-related conditions. ClinVar contains an entry for this variant (Variation ID: 129327). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -