Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.
The NM_001161352.2(KCNMA1):c.31_51dupAGCAGCGGCGGCGGCGGCGGC(p.Gly17_Gly18insSerSerGlyGlyGlyGlyGly) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000984 in 1,524,852 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
KCNMA1 (HGNC:6284): (potassium calcium-activated channel subfamily M alpha 1) This gene encodes the alpha subunit of calcium-activated BK channel. The encoded protein is involved in several physiological processes including smooth muscle contraction, neurotransmitter release and neuronal excitability. Mutations in this gene are associated with a spectrum of neurological disorders including Paroxysmal Nonkinesigenic Dyskinesia 3, Idiopathic Generalized Epilepsy 16 and Liang-Wang syndrome. [provided by RefSeq, Aug 2022]
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This variant has not been reported in the literature in individuals affected with KCNMA1-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 1485982). This variant is not present in population databases (gnomAD no frequency). This variant, c.31_51dup, results in the insertion of 7 amino acid(s) of the KCNMA1 protein (p.Ser11_Gly17dup), but otherwise preserves the integrity of the reading frame. -