rs1484259264

Variant names:

• chr10-77637591-CGCCGCCGCCGCCGCCGCTGCT-C
• rs1484259264
• NM_001161352.2:c.31_51delAGCAGCGGCGGCGGCGGCGGC

Your query was ambiguous. Multiple possible variants found:

• chr10-77637591-CGCCGCCGCCGCCGCCGCTGCT-C
• chr10-77637591-CGCCGCCGCCGCCGCCGCTGCT-CGCCGCCGCCGCCGCCGCTGCTGCCGCCGCCGCCGCCGCTGCT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_001161352.2(KCNMA1):​c.31_51delAGCAGCGGCGGCGGCGGCGGC​(p.Ser11_Gly17del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000201 in 1,524,956 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00014 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00021 (0 hom.)
• Consequence: KCNMA1 NM_001161352.2 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:4 B:1
• Conservation: PhyloP100: 4.78

Genes affected

KCNMA1 (HGNC:6284): (potassium calcium-activated channel subfamily M alpha 1) This gene encodes the alpha subunit of calcium-activated BK channel. The encoded protein is involved in several physiological processes including smooth muscle contraction, neurotransmitter release and neuronal excitability. Mutations in this gene are associated with a spectrum of neurological disorders including Paroxysmal Nonkinesigenic Dyskinesia 3, Idiopathic Generalized Epilepsy 16 and Liang-Wang syndrome. [provided by RefSeq, Aug 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNMA1	NM_001161352.2	c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 28	ENST00000286628.14	NP_001154824.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNMA1	ENST00000286628.14	c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 28	1	NM_001161352.2	ENSP00000286628.8

Frequencies

GnomAD3 genomes AF: 0.000138 AC: 21 AN: 151640 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000266

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000262

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000208

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000737

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000161 AC: 20 AN: 124434 Hom.: 0 AF XY: 0.000147 AC XY: 10 AN XY: 68068

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000216

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000399

Gnomad SAS exome AF: 0.0000474

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000212

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000208 AC: 285 AN: 1373208 Hom.: 0 AF XY: 0.000222 AC XY: 150 AN XY: 677092

Gnomad4 AFR exome AF: 0.000226

Gnomad4 AMR exome AF: 0.000347

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000199

Gnomad4 SAS exome AF: 0.0000899

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000229

Gnomad4 OTH exome AF: 0.000105

GnomAD4 genome AF: 0.000138 AC: 21 AN: 151748 Hom.: 0 Cov.: 32 AF XY: 0.0000674 AC XY: 5 AN XY: 74154

Gnomad4 AFR AF: 0.000266

Gnomad4 AMR AF: 0.000262

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000208

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000737

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000169 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:4 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:2 Benign:1

Nov 21, 2019

Athena Diagnostics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Apr 09, 2018

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Nov 18, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Observed as heterozygous variant in one patient with epilepsy and developmental delay in published literature; however, no further information was provided (PMID: 34224328); In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis indicates that this variant does not alter protein structure/function; This variant is associated with the following publications: (PMID: 34224328) -

Cerebellar atrophy, developmental delay, and seizures Uncertain:1

Oct 11, 2019

New York Genome Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Generalized epilepsy-paroxysmal dyskinesia syndrome Uncertain:1

Feb 02, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.31_51del, results in the deletion of 7 amino acid(s) of the KCNMA1 protein (p.Ser11_Gly17del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with clinical features of KCNMA1-related conditions (internal data). ClinVar contains an entry for this variant (Variation ID: 464298). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1484259264; hg19: chr10-79397349;