10-93062738-AGCCGCGCCGCGCTGGAGCGCTACGT-A

Variant names:

• chr10-93062738-AGCCGCGCCGCGCTGGAGCGCTACGT-A
• rs1385227341
• NM_183374.3:c.457_481delGCGCTGGAGCGCTACGTGCCGCGCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_183374.3(CYP26C1):​c.457_481delGCGCTGGAGCGCTACGTGCCGCGCC​(p.Ala153CysfsTer109) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000779 in 1,284,376 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 7.8e-7 (0 hom.)
• Consequence: CYP26C1 NM_183374.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.11

Genes affected

CYP26C1 (HGNC:20577): (cytochrome P450 family 26 subfamily C member 1) This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is involved in the catabolism of all-trans- and 9-cis-retinoic acid, and thus contributes to the regulation of retinoic acid levels in cells and tissues. This gene is adjacent to a related gene on chromosome 10q23.33. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 10-93062738-AGCCGCGCCGCGCTGGAGCGCTACGT-A is Pathogenic according to our data. Variant chr10-93062738-AGCCGCGCCGCGCTGGAGCGCTACGT-A is described in ClinVar as [Pathogenic]. Clinvar id is 2081971.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CYP26C1	NM_183374.3	c.457_481delGCGCTGGAGCGCTACGTGCCGCGCC	p.Ala153CysfsTer109	frameshift_variant	Exon 3 of 6	ENST00000651965.1	NP_899230.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CYP26C1	ENST00000651965.1	c.457_481delGCGCTGGAGCGCTACGTGCCGCGCC	p.Ala153CysfsTer109	frameshift_variant	Exon 3 of 6		NM_183374.3	ENSP00000498424.1
CYP26C1	ENST00000624358.3	n.457_481delGCGCTGGAGCGCTACGTGCCGCGCC		non_coding_transcript_exon_variant	Exon 3 of 6	2		ENSP00000485098.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD3 exomes AF: 0.0000218 AC: 1 AN: 45794 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 25596

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000107

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 7.79e-7 AC: 1 AN: 1284376 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 627926

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000516

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Jun 28, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Ala153Cysfs*109) in the CYP26C1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CYP26C1 are known to be pathogenic (PMID: 23161670, 28170084). This variant is present in population databases (no rsID available, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with CYP26C1-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1385227341; hg19: chr10-94822495;