11-108223118-GAGAGGAGTCGGGATCTGCGCTGCAGCCACCGCCGCGGTTGATACTACTTTGACCTTCCGAGTGCAGTGGTAGGGGCGCGGAGGCAACGCAGCGGCTTCTGCGCTGGGAAATTCAGTCGTGTGCGACCCAGTCTGTCCTCTCCCC-G

Position:

• chr11-108223118-GAGAGGAGTCGGGATCTGCGCTGCAGCCACCGCCGCGGTTGATACTACTTTGACCTTCCGAGTGCAGTGGTAGGGGCGCGGAGGCAACGCAGCGGCTTCTGCGCTGGGAAATTCAGTCGTGTGCGACCCAGTCTGTCCTCTCCCC-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_000051.4(ATM):​c.-95_-31+79del variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM NM_000051.4 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.784

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.012975684 fraction of the gene.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATM	NM_000051.4	c.-95_-31+79del		splice_region_variant	1/63	ENST00000675843.1	NP_000042.3
ATM	NM_000051.4	c.-95_-31+79del		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	1/63	ENST00000675843.1	NP_000042.3
ATM	NM_000051.4	c.-95_-31+79del		non_coding_transcript_variant		ENST00000675843.1	NP_000042.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATM	ENST00000675843.1	c.-95_-31+79del		splice_region_variant	1/63		NM_000051.4	ENSP00000501606.1
ATM	ENST00000675843	c.-95_-31+79del		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	1/63		NM_000051.4	ENSP00000501606.1
ATM	ENST00000675843.1	c.-95_-31+79del		non_coding_transcript_variant			NM_000051.4	ENSP00000501606.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Quest Diagnostics Nichols Institute San Juan Capistrano

Mar 28, 2024

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-108093845;