11-108223118-GAGAGGAGTCGGGATCTGCGCTGCAGCCACCGCCGCGGTTGATACTACTTTGACCTTCCGAGTGCAGTGGTAGGGGCGCGGAGGCAACGCAGCGGCTTCTGCGCTGGGAAATTCAGTCGTGTGCGACCCAGTCTGTCCTCTCCCC-G

Variant names:

• chr11-108223118-GAGAGGAGTCGGGATCTGCGCTGCAGCCACCGCCGCGGTTGATACTACTTTGACCTTCCGAGTGCAGTGGTAGGGGCGCGGAGGCAACGCAGCGGCTTCTGCGCTGGGAAATTCAGTCGTGTGCGACCCAGTCTGTCCTCTCCCC-G
• NM_000051.4:c.-95_-31+79del

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_000051.4(ATM):​c.-95_-31+79del variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM NM_000051.4 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.784
• Publications: 0 publications found

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

ATM Gene-Disease associations (from GenCC):

• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics, ClinGen
• ataxia telangiectasia

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P, ClinGen, Laboratory for Molecular Medicine, Orphanet
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: MODERATE, LIMITED Submitted by: ClinGen, Ambry Genetics
• prostate cancer

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• sarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• familial ovarian cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• gastric carcinoma

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.013084724 fraction of the gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATM	NM_000051.4	c.-95_-31+79del		splice_region_variant	Exon 1 of 63	ENST00000675843.1	NP_000042.3
ATM	NM_000051.4	c.-95_-31+79del		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 63	ENST00000675843.1	NP_000042.3
ATM	NM_000051.4	c.-95_-31+79del		non_coding_transcript_variant		ENST00000675843.1	NP_000042.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATM	ENST00000675843.1	c.-95_-31+79del		splice_region_variant	Exon 1 of 63		NM_000051.4	ENSP00000501606.1
ATM	ENST00000675843.1	c.-95_-31+79del		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 63		NM_000051.4	ENSP00000501606.1
ATM	ENST00000675843.1	c.-95_-31+79del		non_coding_transcript_variant			NM_000051.4	ENSP00000501606.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Mar 28, 2024

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.78

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr11-108093845;