chr11-108223118-GAGAGGAGTCGGGATCTGCGCTGCAGCCACCGCCGCGGTTGATACTACTTTGACCTTCCGAGTGCAGTGGTAGGGGCGCGGAGGCAACGCAGCGGCTTCTGCGCTGGGAAATTCAGTCGTGTGCGACCCAGTCTGTCCTCTCCCC-G

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_000051.4(ATM):​c.-95_-31+79del variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

ATM
NM_000051.4 splice_donor, splice_region, 5_prime_UTR, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.784

Publications

0 publications found
Variant links:
Genes affected
ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
ATM Gene-Disease associations (from GenCC):
  • hereditary breast carcinoma
    Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics, ClinGen
  • ataxia telangiectasia
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P, ClinGen, Laboratory for Molecular Medicine, Orphanet
  • hereditary nonpolyposis colon cancer
    Inheritance: AD Classification: MODERATE, LIMITED Submitted by: ClinGen, Ambry Genetics
  • prostate cancer
    Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
  • sarcoma
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • familial ovarian cancer
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen
  • gastric carcinoma
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.013084724 fraction of the gene.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ATMNM_000051.4 linkc.-95_-31+79del splice_region_variant Exon 1 of 63 ENST00000675843.1 NP_000042.3 Q13315A0A024R3C7
ATMNM_000051.4 linkc.-95_-31+79del splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant Exon 1 of 63 ENST00000675843.1 NP_000042.3 Q13315A0A024R3C7
ATMNM_000051.4 linkc.-95_-31+79del non_coding_transcript_variant ENST00000675843.1 NP_000042.3 Q13315A0A024R3C7

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ATMENST00000675843.1 linkc.-95_-31+79del splice_region_variant Exon 1 of 63 NM_000051.4 ENSP00000501606.1 Q13315
ATMENST00000675843.1 linkc.-95_-31+79del splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant Exon 1 of 63 NM_000051.4 ENSP00000501606.1 Q13315
ATMENST00000675843.1 linkc.-95_-31+79del non_coding_transcript_variant NM_000051.4 ENSP00000501606.1 Q13315

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Mar 28, 2024
Quest Diagnostics Nichols Institute San Juan Capistrano
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.78

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

hg19: chr11-108093845; API