11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T

Position:

• chr11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000051.4(ATM):​c.5763-18_5772delTATCTCATTTTTCTTTAGACCTTCTTCA​(p.Pro1922fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM NM_000051.4 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.87

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ATM (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T is Pathogenic according to our data. Variant chr11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2587785.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATM	NM_000051.4	c.5763-18_5772delTATCTCATTTTTCTTTAGACCTTCTTCA	p.Pro1922fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	39/63	ENST00000675843.1	NP_000042.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATM	ENST00000675843.1	c.5763-18_5772delTATCTCATTTTTCTTTAGACCTTCTTCA	p.Pro1922fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	39/63		NM_000051.4	ENSP00000501606.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Jul 21, 2023

The c.5763-18_5772del28 variant results from a deletion of 28 nucleotides between positions c.5763-18 to c.5772 and involves the canonical splice acceptor site before coding exon 38 of the ATM gene. The nucleotide positions at this acceptor site are highly conserved in available vertebrate species. Alterations that disrupt the canonical splice site are expected to result in aberrant splicing. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site. The resulting transcript is predicted to be in-frame and is not expected to trigger nonsense-mediated mRNAdecay; however, direct evidence is unavailable. The exact functional effect of the altered amino acid sequence is unknown; however, and the impacted region is critical for protein function (Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-108180867;