11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_ModeratePM2PP5_Moderate

The ENST00000675843.1(ATM):​c.5763-19_5771delATATCTCATTTTTCTTTAGACCTTCTTC​(p.Pro1922_Ser1924del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R1921R) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

ATM
ENST00000675843.1 splice_acceptor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.87
Variant links:
Genes affected
ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.017010141 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4, offset of -40, new splice context is: cttttattttgatattgaAGttt. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T is Pathogenic according to our data. Variant chr11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2587785.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ATMNM_000051.4 linkc.5763-18_5772delTATCTCATTTTTCTTTAGACCTTCTTCA p.Pro1922fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 39 of 63 ENST00000675843.1 NP_000042.3 Q13315A0A024R3C7

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ATMENST00000675843.1 linkc.5763-19_5771delATATCTCATTTTTCTTTAGACCTTCTTC p.Pro1922_Ser1924del splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 39 of 63 NM_000051.4 ENSP00000501606.1 Q13315

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1
Jul 21, 2023
Ambry Genetics
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.5763-18_5772del28 variant results from a deletion of 28 nucleotides between positions c.5763-18 to c.5772 and involves the canonical splice acceptor site before coding exon 38 of the ATM gene. The nucleotide positions at this acceptor site are highly conserved in available vertebrate species. Alterations that disrupt the canonical splice site are expected to result in aberrant splicing. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site. The resulting transcript is predicted to be in-frame and is not expected to trigger nonsense-mediated mRNAdecay; however, direct evidence is unavailable. The exact functional effect of the altered amino acid sequence is unknown; however, and the impacted region is critical for protein function (Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-108180867; API