chr11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T

Variant names:

• chr11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T
• ENST00000527805.6:n.*827-19_*835delATATCTCATTTTTCTTTAGACCTTCTTC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Moderate PP5_Moderate

The ENST00000675843.1(ATM):​c.5763-19_5771delATATCTCATTTTTCTTTAGACCTTCTTC​(p.Pro1922_Ser1924del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R1921R) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ATM ENST00000675843.1 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.87
• Publications: 0 publications found

Genes affected

ATM (HGNC:795): (ATM serine/threonine kinase) The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]

C11orf65 (HGNC:28519): (chromosome 11 open reading frame 65) Predicted to be involved in negative regulation of mitochondrial fission and negative regulation of protein targeting to mitochondrion. Predicted to be located in cytosol and mitochondrial outer membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.017010141 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4, offset of -40, new splice context is: cttttattttgatattgaAGttt. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PP5: Variant 11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T is Pathogenic according to our data. Variant chr11-108310140-TATATCTCATTTTTCTTTAGACCTTCTTC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2587785.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATM	NM_000051.4	c.5763-18_5772delTATCTCATTTTTCTTTAGACCTTCTTCA	p.Pro1922fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 39 of 63	ENST00000675843.1	NP_000042.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATM	ENST00000675843.1	c.5763-19_5771delATATCTCATTTTTCTTTAGACCTTCTTC	p.Pro1922_Ser1924del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 39 of 63		NM_000051.4	ENSP00000501606.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Jul 21, 2023

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.5763-18_5772del28 variant results from a deletion of 28 nucleotides between positions c.5763-18 to c.5772 and involves the canonical splice acceptor site before coding exon 38 of the ATM gene. The nucleotide positions at this acceptor site are highly conserved in available vertebrate species. Alterations that disrupt the canonical splice site are expected to result in aberrant splicing. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site. The resulting transcript is predicted to be in-frame and is not expected to trigger nonsense-mediated mRNAdecay; however, direct evidence is unavailable. The exact functional effect of the altered amino acid sequence is unknown; however, and the impacted region is critical for protein function (Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr11-108180867;