11-117986465-AGGATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCAT-A

Position:

• chr11-117986465-AGGATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCAT-A

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_Strong PM2 PP5

The NM_001558.4(IL10RA):​c.1_67+1delATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCATGG​(p.Met1fs) variant causes a frameshift, start lost, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: IL10RA NM_001558.4 frameshift, start_lost, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 3.88

Genes affected

IL10RA (HGNC:5964): (interleukin 10 receptor subunit alpha) The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]

IL10RA (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 4 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-117986465-AGGATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCAT-A is Pathogenic according to our data. Variant chr11-117986465-AGGATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCAT-A is described in ClinVar as [Pathogenic]. Clinvar id is 1048075.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
IL10RA	NM_001558.4	c.1_67+1delATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCATGG	p.Met1fs	frameshift_variant, start_lost, splice_donor_variant, splice_region_variant, intron_variant	1/7	ENST00000227752.8	NP_001549.2
IL10RA	XM_047426882.1	c.-339_-272delATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCATGG		5_prime_UTR_variant	1/7		XP_047282838.1
IL10RA	NR_026691.2	n.75_141+1delATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCATGG		splice_donor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	1/8

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
IL10RA	ENST00000227752.8	c.1_67+1delATGCTGCCGTGCCTCGTAGTGCTGCTGGCGGCGCTCCTCAGCCTCCGTCTTGGCTCAGACGCTCATGG	p.Met1fs	frameshift_variant, start_lost, splice_donor_variant, splice_region_variant, intron_variant	1/7	1	NM_001558.4	ENSP00000227752.4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Inflammatory bowel disease 28 Pathogenic:1

Pathogenic, no assertion criteria provided

clinical testing

Center for Molecular Medicine, Children’s Hospital of Fudan University

Feb 25, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2057986431; hg19: chr11-117857180;