11-121127893-T-TCAGCACCAGCCAGTGCGTCCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_005422.4(TECTA):​c.1917_1937dupCAGCACCAGCCAGTGCGTCCC​(p.Pro646_Leu647insSerThrSerGlnCysValPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

TECTA
NM_005422.4 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.909

Publications

0 publications found
Variant links:
Genes affected
TECTA (HGNC:11720): (tectorin alpha) The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
TBCEL-TECTA (HGNC:54857): (TBCEL-TECTA readthrough) Predicted to enable alpha-tubulin binding activity. Predicted to be involved in microtubule cytoskeleton organization; post-chaperonin tubulin folding pathway; and tubulin complex assembly. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_005422.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TECTANM_005422.4 linkc.1917_1937dupCAGCACCAGCCAGTGCGTCCC p.Pro646_Leu647insSerThrSerGlnCysValPro disruptive_inframe_insertion Exon 9 of 24 ENST00000392793.6 NP_005413.2 O75443
TBCEL-TECTANM_001378761.1 linkc.2874_2894dupCAGCACCAGCCAGTGCGTCCC p.Pro965_Leu966insSerThrSerGlnCysValPro disruptive_inframe_insertion Exon 15 of 30 NP_001365690.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TECTAENST00000392793.6 linkc.1917_1937dupCAGCACCAGCCAGTGCGTCCC p.Pro646_Leu647insSerThrSerGlnCysValPro disruptive_inframe_insertion Exon 9 of 24 5 NM_005422.4 ENSP00000376543.1 O75443
TECTAENST00000264037.2 linkc.1917_1937dupCAGCACCAGCCAGTGCGTCCC p.Pro646_Leu647insSerThrSerGlnCysValPro disruptive_inframe_insertion Exon 8 of 23 1 ENSP00000264037.2 O75443
TECTAENST00000642222.1 linkc.1917_1937dupCAGCACCAGCCAGTGCGTCCC p.Pro646_Leu647insSerThrSerGlnCysValPro disruptive_inframe_insertion Exon 9 of 24 ENSP00000493855.1 A0A2R8YDL0

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Jul 25, 2018
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The p.Ser640_Pro646dup variant in TECTA has been reported by our laboratory in 1 individual with congenital hearing loss and segregated in 1 affected sibling. T his variant was absent from large population studies, though the ability of thes e studies to accurately detect large indels of this size may be limited. This va riant is a tandem duplication of 7 amino acids at positions 640 to 646 and is no t predicted to alter the protein reading-frame. This region of the protein is co nserved across mammalian species, though it is unclear if this duplication will impact protein function. In summary, the clinical significance of the p.Ser640_P ro646dup variant is uncertain. ACMG/AMP criteria applied: PM4. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.91

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555123919; hg19: chr11-120998602; API