rs1555123919
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_005422.4(TECTA):c.1917_1937dupCAGCACCAGCCAGTGCGTCCC(p.Pro646_Leu647insSerThrSerGlnCysValPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene TECTA is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_005422.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005422.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TECTA | MANE Select | c.1917_1937dupCAGCACCAGCCAGTGCGTCCC | p.Pro646_Leu647insSerThrSerGlnCysValPro | disruptive_inframe_insertion | Exon 9 of 24 | NP_005413.2 | O75443 | ||
| TBCEL-TECTA | c.2874_2894dupCAGCACCAGCCAGTGCGTCCC | p.Pro965_Leu966insSerThrSerGlnCysValPro | disruptive_inframe_insertion | Exon 15 of 30 | NP_001365690.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TECTA | TSL:5 MANE Select | c.1917_1937dupCAGCACCAGCCAGTGCGTCCC | p.Pro646_Leu647insSerThrSerGlnCysValPro | disruptive_inframe_insertion | Exon 9 of 24 | ENSP00000376543.1 | O75443 | ||
| TECTA | TSL:1 | c.1917_1937dupCAGCACCAGCCAGTGCGTCCC | p.Pro646_Leu647insSerThrSerGlnCysValPro | disruptive_inframe_insertion | Exon 8 of 23 | ENSP00000264037.2 | O75443 | ||
| TECTA | c.1917_1937dupCAGCACCAGCCAGTGCGTCCC | p.Pro646_Leu647insSerThrSerGlnCysValPro | disruptive_inframe_insertion | Exon 9 of 24 | ENSP00000493855.1 | A0A2R8YDL0 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.