rs1555123919

Variant names:

• chr11-121127893-T-TCAGCACCAGCCAGTGCGTCCC
• rs1555123919
• NM_005422.4:c.1917_1937dupCAGCACCAGCCAGTGCGTCCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_005422.4(TECTA):​c.1917_1937dupCAGCACCAGCCAGTGCGTCCC​(p.Pro646_Leu647insSerThrSerGlnCysValPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TECTA NM_005422.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.909

Genes affected

TECTA (HGNC:11720): (tectorin alpha) The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]

TBCEL-TECTA (HGNC:54857): (TBCEL-TECTA readthrough) Predicted to enable alpha-tubulin binding activity. Predicted to be involved in microtubule cytoskeleton organization; post-chaperonin tubulin folding pathway; and tubulin complex assembly. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_005422.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TECTA	NM_005422.4	c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 9 of 24	ENST00000392793.6	NP_005413.2
TBCEL-TECTA	NM_001378761.1	c.2874_2894dupCAGCACCAGCCAGTGCGTCCC	p.Pro965_Leu966insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 15 of 30		NP_001365690.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TECTA	ENST00000392793.6	c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 9 of 24	5	NM_005422.4	ENSP00000376543.1
TECTA	ENST00000264037.2	c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 8 of 23	1		ENSP00000264037.2
TECTA	ENST00000642222.1	c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 9 of 24			ENSP00000493855.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Jul 25, 2018

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Ser640_Pro646dup variant in TECTA has been reported by our laboratory in 1 individual with congenital hearing loss and segregated in 1 affected sibling. T his variant was absent from large population studies, though the ability of thes e studies to accurately detect large indels of this size may be limited. This va riant is a tandem duplication of 7 amino acids at positions 640 to 646 and is no t predicted to alter the protein reading-frame. This region of the protein is co nserved across mammalian species, though it is unclear if this duplication will impact protein function. In summary, the clinical significance of the p.Ser640_P ro646dup variant is uncertain. ACMG/AMP criteria applied: PM4. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555123919; hg19: chr11-120998602;