rs1555123919

Variant names:

• chr11-121127893-T-TCAGCACCAGCCAGTGCGTCCC
• rs1555123919
• NM_005422.4:c.1917_1937dupCAGCACCAGCCAGTGCGTCCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_005422.4(TECTA):​c.1917_1937dupCAGCACCAGCCAGTGCGTCCC​(p.Pro646_Leu647insSerThrSerGlnCysValPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). The gene TECTA is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: TECTA NM_005422.4 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.909
• Publications: 0 publications found

Genes affected

TECTA (HGNC:11720): (tectorin alpha) The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]

TBCEL-TECTA (HGNC:54857): (TBCEL-TECTA readthrough) Predicted to enable alpha-tubulin binding activity. Predicted to be involved in microtubule cytoskeleton organization; post-chaperonin tubulin folding pathway; and tubulin complex assembly. Predicted to be active in cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Specifications for TECTA are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_005422.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005422.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TECTA	NM_005422.4	MANE Select	c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 9 of 24	NP_005413.2	O75443
	TBCEL-TECTA	NM_001378761.1		c.2874_2894dupCAGCACCAGCCAGTGCGTCCC	p.Pro965_Leu966insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 15 of 30	NP_001365690.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TECTA	ENST00000392793.6	TSL:5 MANE Select	c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 9 of 24	ENSP00000376543.1	O75443
	TECTA	ENST00000264037.2	TSL:1	c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 8 of 23	ENSP00000264037.2	O75443
	TECTA	ENST00000642222.1		c.1917_1937dupCAGCACCAGCCAGTGCGTCCC	p.Pro646_Leu647insSerThrSerGlnCysValPro	disruptive_inframe_insertion	Exon 9 of 24	ENSP00000493855.1	A0A2R8YDL0

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.91

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555123919; hg19: chr11-120998602;