11-133125672-TAGTATATGTATATAGTATATATAGTATATATATAGTG-T

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_001012393.5(OPCML):​c.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (no stars).

Frequency

Genomes: not found (cov: 0)

Consequence

OPCML
NM_001012393.5 intron

Scores

Not classified

Clinical Significance

Uncertain significance no assertion criteria provided U:1

Conservation

PhyloP100: 0.271
Variant links:
Genes affected
OPCML (HGNC:8143): (opioid binding protein/cell adhesion molecule like) This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
OPCMLNM_001012393.5 linkc.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT intron_variant Intron 1 of 7 ENST00000524381.6 NP_001012393.1 Q14982-2
OPCMLNM_001319104.4 linkc.-134+406555_-134+406591delCACTATATATATACTATATATACTATATACATATACT intron_variant Intron 1 of 6 NP_001306033.1 Q14982B2CZX3
OPCMLXM_006718846.4 linkc.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT intron_variant Intron 1 of 7 XP_006718909.1
OPCMLXM_047427032.1 linkc.-42+171315_-42+171351delCACTATATATATACTATATATACTATATACATATACT intron_variant Intron 1 of 7 XP_047282988.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
OPCMLENST00000524381.6 linkc.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT intron_variant Intron 1 of 7 1 NM_001012393.5 ENSP00000434750.1 Q14982-2
OPCMLENST00000529038.5 linkn.139+406555_139+406591delCACTATATATATACTATATATACTATATACATATACT intron_variant Intron 1 of 6 5

Frequencies

GnomAD3 genomes
Cov.:
0
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
0

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Schizophrenia Uncertain:1
Nov 11, 2022
Department of Psychiatry, The University of Hong Kong
Significance: Uncertain significance
Review Status: no assertion criteria provided
Collection Method: case-control

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-132995567; API