11-133125672-TAGTATATGTATATAGTATATATAGTATATATATAGTG-T

Position:

• chr11-133125672-TAGTATATGTATATAGTATATATAGTATATATATAGTG-T

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_001012393.5(OPCML):​c.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 0)
• Consequence: OPCML NM_001012393.5 intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 0.271

Genes affected

OPCML (HGNC:8143): (opioid binding protein/cell adhesion molecule like) This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
OPCML	NM_001012393.5	c.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT		intron_variant		ENST00000524381.6	NP_001012393.1
OPCML	NM_001319104.4	c.-134+406555_-134+406591delCACTATATATATACTATATATACTATATACATATACT		intron_variant			NP_001306033.1
OPCML	XM_006718846.4	c.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT		intron_variant			XP_006718909.1
OPCML	XM_047427032.1	c.-42+171315_-42+171351delCACTATATATATACTATATATACTATATACATATACT		intron_variant			XP_047282988.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
OPCML	ENST00000524381.6	c.62-182699_62-182663delCACTATATATATACTATATATACTATATACATATACT		intron_variant		1	NM_001012393.5	ENSP00000434750.1
OPCML	ENST00000529038.5	n.139+406555_139+406591delCACTATATATATACTATATATACTATATACATATACT		intron_variant		5

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

Schizophrenia Uncertain:1

Uncertain significance, no assertion criteria provided

case-control

Department of Psychiatry, The University of Hong Kong

Nov 11, 2022

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-132995567;