11-2884866-CGGGGCCGGGGCCGGGGCCGGGGCT-C
Variant summary
Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP6BS2
The NM_001122630.2(CDKN1C):c.567_590delAGCCCCGGCCCCGGCCCCGGCCCC(p.Ala190_Pro197del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000803 in 793,628 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. P189P) has been classified as Benign.
Frequency
Consequence
NM_001122630.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -5 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CDKN1C | NM_001122630.2 | c.567_590delAGCCCCGGCCCCGGCCCCGGCCCC | p.Ala190_Pro197del | disruptive_inframe_deletion | 2/4 | ENST00000440480.8 | NP_001116102.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CDKN1C | ENST00000440480.8 | c.567_590delAGCCCCGGCCCCGGCCCCGGCCCC | p.Ala190_Pro197del | disruptive_inframe_deletion | 2/4 | 1 | NM_001122630.2 | ENSP00000411257.2 |
Frequencies
GnomAD3 genomes AF: 0.000308 AC: 41AN: 133260Hom.: 0 Cov.: 32
GnomAD4 exome AF: 0.000903 AC: 596AN: 660368Hom.: 0 AF XY: 0.000888 AC XY: 276AN XY: 310650
GnomAD4 genome AF: 0.000308 AC: 41AN: 133260Hom.: 0 Cov.: 32 AF XY: 0.000324 AC XY: 21AN XY: 64878
ClinVar
Submissions by phenotype
not provided Uncertain:1Benign:1
Uncertain significance, criteria provided, single submitter | clinical testing | Revvity Omics, Revvity | Jan 20, 2022 | - - |
Likely benign, criteria provided, single submitter | clinical testing | CeGaT Center for Human Genetics Tuebingen | Sep 01, 2024 | CDKN1C: BS1 - |
Beckwith-Wiedemann syndrome Benign:2
Benign, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 30, 2024 | - - |
Likely benign, criteria provided, single submitter | curation | Sema4, Sema4 | Jun 28, 2021 | - - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at