rs878853637

Positions:

• chr11-2884866-CGGGGCCGGGGCCGGGGCCGGGGCT-C
• chr11-2884866-CGGGGCCGGGGCCGGGGCCGGGGCT-CGGGGCCGGGGCCGGGGCCGGGGCTGGGGCCGGGGCCGGGGCCGGGGCT

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP6 BS2

The NM_001122630.2(CDKN1C):​c.567_590delAGCCCCGGCCCCGGCCCCGGCCCC​(p.Ala190_Pro197del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000803 in 793,628 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. P189P) has been classified as Benign.

• Frequency:
  • Genomes: 𝑓 0.00031 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00090 (0 hom.)
• Consequence: CDKN1C NM_001122630.2 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 1.91

Genes affected

CDKN1C (HGNC:1786): (cyclin dependent kinase inhibitor 1C) This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

CDKN1C (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP6: Variant 11-2884866-CGGGGCCGGGGCCGGGGCCGGGGCT-C is Benign according to our data. Variant chr11-2884866-CGGGGCCGGGGCCGGGGCCGGGGCT-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 236963.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=2, Uncertain_significance=1, Benign=1}.
• BS2: High AC in GnomAd4 at 41 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CDKN1C	NM_001122630.2	c.567_590delAGCCCCGGCCCCGGCCCCGGCCCC	p.Ala190_Pro197del	disruptive_inframe_deletion	2/4	ENST00000440480.8	NP_001116102.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CDKN1C	ENST00000440480.8	c.567_590delAGCCCCGGCCCCGGCCCCGGCCCC	p.Ala190_Pro197del	disruptive_inframe_deletion	2/4	1	NM_001122630.2	ENSP00000411257.2

Frequencies

GnomAD3 genomes AF: 0.000308 AC: 41 AN: 133260 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000159

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000216

Gnomad SAS AF: 0.000465

Gnomad FIN AF: 0.000128

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000519

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000903 AC: 596 AN: 660368 Hom.: 0 AF XY: 0.000888 AC XY: 276 AN XY: 310650

Gnomad4 AFR exome AF: 0.000235

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000167

Gnomad4 SAS exome AF: 0.000145

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000954

Gnomad4 OTH exome AF: 0.00110

GnomAD4 genome AF: 0.000308 AC: 41 AN: 133260 Hom.: 0 Cov.: 32 AF XY: 0.000324 AC XY: 21 AN XY: 64878

Gnomad4 AFR AF: 0.000159

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000216

Gnomad4 SAS AF: 0.000465

Gnomad4 FIN AF: 0.000128

Gnomad4 NFE AF: 0.000519

Gnomad4 OTH AF: 0.00

Alfa AF: 0.000506 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:1 Benign:1

Uncertain significance, criteria provided, single submitter	clinical testing	Revvity Omics, Revvity	Jan 20, 2022	- -
Likely benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Sep 01, 2024	CDKN1C: BS1 -

Beckwith-Wiedemann syndrome Benign:2

Benign, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jan 30, 2024	- -
Likely benign, criteria provided, single submitter	curation	Sema4, Sema4	Jun 28, 2021	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878853637; hg19: chr11-2906096;