11-47331848-GCCATCCCCAGGAGCCAGCCTGGTC-G

Variant names:

• chr11-47331848-GCCATCCCCAGGAGCCAGCCTGGTC-G
• NM_000256.3:c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000256.3(MYBPC3):​c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG​(p.Ter1275delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: MYBPC3 NM_000256.3 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.665

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Stoplost variant in NM_000256.3 Downstream stopcodon found after 112 codons.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYBPC3	NM_000256.3	c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG	p.Ter1275delins???	stop_lost, conservative_inframe_deletion	Exon 34 of 35	ENST00000545968.6	NP_000247.2
MYBPC3	NM_000256.3	c.3825_*22delGACCAGGCTGGCTCCTGGGGATGG		3_prime_UTR_variant	Exon 34 of 35	ENST00000545968.6	NP_000247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYBPC3	ENST00000545968.6	c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG	p.Ter1275delins???	stop_lost, conservative_inframe_deletion	Exon 34 of 35	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000545968	c.3825_*22delGACCAGGCTGGCTCCTGGGGATGG		3_prime_UTR_variant	Exon 34 of 35	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000399249.6	c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG	p.Ter1275delins???	stop_lost, conservative_inframe_deletion	Exon 33 of 34	5		ENSP00000382193.2
MYBPC3	ENST00000399249	c.3825_*22delGACCAGGCTGGCTCCTGGGGATGG		3_prime_UTR_variant	Exon 33 of 34	5		ENSP00000382193.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Cardiovascular phenotype Uncertain:1

Jun 16, 2016

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3824_*22del24 variant occurs at the 3' terminus of coding exon 34 and spans into the 3' untranslated region (UTR) of the MYBPC3 gene. This variant results from a deletion of 24 nucleotides at positions c.3824 to c.*22, causing a translational frameshift with a predicted alternate stop codon resulting in the elongation of the protein by 68 amino acids. This variant was not reported in population-based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP) and 1000 Genomes Project. Per ACMG guidelines this variant could be interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med 2008;10:294); however this deletion and subsequent frameshift occur at the 3' terminus of MYBPC3 and results in the elongation of the protein. The exact functional impact of these inserted amino acids is unknown at this time. Since supporting evidence is limited at this time, the clinical significance of c.3824_*22del24 remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-47353399;