11-47331848-GCCATCCCCAGGAGCCAGCCTGGTC-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_000256.3(MYBPC3):​c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG​(p.Ter1275delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

MYBPC3
NM_000256.3 stop_lost, conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.665
Variant links:
Genes affected
MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Stoplost variant in NM_000256.3 Downstream stopcodon found after 146 codons.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MYBPC3NM_000256.3 linkc.3824_*22delGACCAGGCTGGCTCCTGGGGATGG p.Ter1275delins??? stop_lost, conservative_inframe_deletion 34/35 ENST00000545968.6 NP_000247.2 Q14896-1A5YM48
MYBPC3NM_000256.3 linkc.3822_*22delGACCAGGCTGGCTCCTGGGGATGG 3_prime_UTR_variant 34/35 ENST00000545968.6 NP_000247.2 Q14896-1A5YM48

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MYBPC3ENST00000545968.6 linkc.3824_*22delGACCAGGCTGGCTCCTGGGGATGG p.Ter1275delins??? stop_lost, conservative_inframe_deletion 34/355 NM_000256.3 ENSP00000442795.1 Q14896-1
MYBPC3ENST00000545968 linkc.3822_*22delGACCAGGCTGGCTCCTGGGGATGG 3_prime_UTR_variant 34/355 NM_000256.3 ENSP00000442795.1 Q14896-1
MYBPC3ENST00000399249.6 linkc.3824_*22delGACCAGGCTGGCTCCTGGGGATGG p.Ter1275delins??? stop_lost, conservative_inframe_deletion 33/345 ENSP00000382193.2 A8MXZ9
MYBPC3ENST00000399249 linkc.3822_*22delGACCAGGCTGGCTCCTGGGGATGG 3_prime_UTR_variant 33/345 ENSP00000382193.2 A8MXZ9

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Cardiovascular phenotype Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingAmbry GeneticsJun 16, 2016The c.3824_*22del24 variant occurs at the 3' terminus of coding exon 34 and spans into the 3' untranslated region (UTR) of the MYBPC3 gene. This variant results from a deletion of 24 nucleotides at positions c.3824 to c.*22, causing a translational frameshift with a predicted alternate stop codon resulting in the elongation of the protein by 68 amino acids. This variant was not reported in population-based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP) and 1000 Genomes Project. Per ACMG guidelines this variant could be interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med 2008;10:294); however this deletion and subsequent frameshift occur at the 3' terminus of MYBPC3 and results in the elongation of the protein. The exact functional impact of these inserted amino acids is unknown at this time. Since supporting evidence is limited at this time, the clinical significance of c.3824_*22del24 remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-47353399; API