chr11-47331848-GCCATCCCCAGGAGCCAGCCTGGTC-G
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000256.3(MYBPC3):c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG(p.Ter1275delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 33)
Consequence
MYBPC3
NM_000256.3 stop_lost, conservative_inframe_deletion
NM_000256.3 stop_lost, conservative_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 0.665
Genes affected
MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 4 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Stoplost variant in NM_000256.3 Downstream stopcodon found after 146 codons.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MYBPC3 | NM_000256.3 | c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG | p.Ter1275delins??? | stop_lost, conservative_inframe_deletion | 34/35 | ENST00000545968.6 | NP_000247.2 | |
MYBPC3 | NM_000256.3 | c.3822_*22delGACCAGGCTGGCTCCTGGGGATGG | 3_prime_UTR_variant | 34/35 | ENST00000545968.6 | NP_000247.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MYBPC3 | ENST00000545968.6 | c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG | p.Ter1275delins??? | stop_lost, conservative_inframe_deletion | 34/35 | 5 | NM_000256.3 | ENSP00000442795.1 | ||
MYBPC3 | ENST00000545968 | c.3822_*22delGACCAGGCTGGCTCCTGGGGATGG | 3_prime_UTR_variant | 34/35 | 5 | NM_000256.3 | ENSP00000442795.1 | |||
MYBPC3 | ENST00000399249.6 | c.3824_*22delGACCAGGCTGGCTCCTGGGGATGG | p.Ter1275delins??? | stop_lost, conservative_inframe_deletion | 33/34 | 5 | ENSP00000382193.2 | |||
MYBPC3 | ENST00000399249 | c.3822_*22delGACCAGGCTGGCTCCTGGGGATGG | 3_prime_UTR_variant | 33/34 | 5 | ENSP00000382193.2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Cardiovascular phenotype Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Ambry Genetics | Jun 16, 2016 | The c.3824_*22del24 variant occurs at the 3' terminus of coding exon 34 and spans into the 3' untranslated region (UTR) of the MYBPC3 gene. This variant results from a deletion of 24 nucleotides at positions c.3824 to c.*22, causing a translational frameshift with a predicted alternate stop codon resulting in the elongation of the protein by 68 amino acids. This variant was not reported in population-based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP) and 1000 Genomes Project. Per ACMG guidelines this variant could be interpreted as a disease-causing mutation (ACMG Recommendations for Standards for Interpretation and Reporting of Sequence Variations. Revision 2007. Genet Med 2008;10:294); however this deletion and subsequent frameshift occur at the 3' terminus of MYBPC3 and results in the elongation of the protein. The exact functional impact of these inserted amino acids is unknown at this time. Since supporting evidence is limited at this time, the clinical significance of c.3824_*22del24 remains unclear. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.