11-61835024-CCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTT-CCTCCCTGCCTCCCCAGGGACTT

Position:

• chr11-61835024-CCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTT-CCTCCCTGCCTCCCCAGGGACTT

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 0P and 8B. BA1

The NM_004265.4(FADS2):​c.208-2713_208-2692delACTTCTCCCTGCCTCCCCAGGG variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: 𝑓 0.56 (24100 hom., cov: 0)
• Consequence: FADS2 NM_004265.4 intron
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 1.13

Genes affected

FADS2 (HGNC:3575): (fatty acid desaturase 2) The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (AMR) allele frequency at 95% confidence interval = 0.731 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FADS2	NM_004265.4	c.208-2713_208-2692delACTTCTCCCTGCCTCCCCAGGG		intron_variant		ENST00000278840.9	NP_004256.1
FADS2	NM_001281501.1	c.142-2713_142-2692delACTTCTCCCTGCCTCCCCAGGG		intron_variant			NP_001268430.1
FADS2	NM_001281502.1	c.115-2713_115-2692delACTTCTCCCTGCCTCCCCAGGG		intron_variant			NP_001268431.1
FADS2	XM_047427889.1	c.208-2713_208-2692delACTTCTCCCTGCCTCCCCAGGG		intron_variant			XP_047283845.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FADS2	ENST00000278840.9	c.208-2713_208-2692delACTTCTCCCTGCCTCCCCAGGG		intron_variant		1	NM_004265.4	ENSP00000278840.4

Frequencies

GnomAD3 genomes AF: 0.564 AC: 77285 AN: 137016 Hom.: 24080 Cov.: 0

Gnomad AFR AF: 0.321

Gnomad AMI AF: 0.663

Gnomad AMR AF: 0.743

Gnomad ASJ AF: 0.750

Gnomad EAS AF: 0.545

Gnomad SAS AF: 0.230

Gnomad FIN AF: 0.632

Gnomad MID AF: 0.733

Gnomad NFE AF: 0.669

Gnomad OTH AF: 0.624

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.564 AC: 77337 AN: 137130 Hom.: 24100 Cov.: 0 AF XY: 0.558 AC XY: 36873 AN XY: 66030

Gnomad4 AFR AF: 0.321

Gnomad4 AMR AF: 0.743

Gnomad4 ASJ AF: 0.750

Gnomad4 EAS AF: 0.544

Gnomad4 SAS AF: 0.232

Gnomad4 FIN AF: 0.632

Gnomad4 NFE AF: 0.669

Gnomad4 OTH AF: 0.623

Asia WGS AF: 0.438 AC: 1519 AN: 3470

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

not provided Other:1

not provided, no classification provided

not provided

Devine Lab Institute for Genome Sciences, University of Maryland School of Medicine

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs66698963; hg19: chr11-61602496;