11-61835024-CCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTT-CCTCCCTGCCTCCCCAGGGACTT

Variant names:

• chr11-61835024-CCTCCCTGCCTCCCCAGGGACTT-C
• rs66698963
• NM_004265.4:c.208-2713_208-2692delACTTCTCCCTGCCTCCCCAGGG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_004265.4(FADS2):​c.208-2713_208-2692delACTTCTCCCTGCCTCCCCAGGG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: 𝑓 0.56 (24100 hom., cov: 0)
• Consequence: FADS2 NM_004265.4 intron
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 1.13
• Publications: 14 publications found

Genes affected

FADS2 (HGNC:3575): (fatty acid desaturase 2) The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (AMR) allele frequency at 95% confidence interval = 0.731 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004265.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FADS2	NM_004265.4	MANE Select	c.208-2713_208-2692delACTTCTCCCTGCCTCCCCAGGG		intron	N/A	NP_004256.1
	FADS2	NM_001281501.1		c.142-2713_142-2692delACTTCTCCCTGCCTCCCCAGGG		intron	N/A	NP_001268430.1
	FADS2	NM_001281502.1		c.115-2713_115-2692delACTTCTCCCTGCCTCCCCAGGG		intron	N/A	NP_001268431.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FADS2	ENST00000278840.9	TSL:1 MANE Select	c.208-2753_208-2732delCTCCCTGCCTCCCCAGGGACTT		intron	N/A	ENSP00000278840.4
	FADS2	ENST00000257261.10	TSL:1	c.142-2753_142-2732delCTCCCTGCCTCCCCAGGGACTT		intron	N/A	ENSP00000257261.6
	FADS2	ENST00000521849.5	TSL:1	c.208-2753_208-2732delCTCCCTGCCTCCCCAGGGACTT		intron	N/A	ENSP00000431091.1

Frequencies

GnomAD3 genomes AF: 0.564 AC: 77285 AN: 137016 Hom.: 24080 Cov.: 0

Gnomad AFR AF: 0.321

Gnomad AMI AF: 0.663

Gnomad AMR AF: 0.743

Gnomad ASJ AF: 0.750

Gnomad EAS AF: 0.545

Gnomad SAS AF: 0.230

Gnomad FIN AF: 0.632

Gnomad MID AF: 0.733

Gnomad NFE AF: 0.669

Gnomad OTH AF: 0.624

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.564 AC: 77337 AN: 137130 Hom.: 24100 Cov.: 0 AF XY: 0.558 AC XY: 36873 AN XY: 66030

African (AFR) AF: 0.321 AC: 11819 AN: 36846

American (AMR) AF: 0.743 AC: 9949 AN: 13386

Ashkenazi Jewish (ASJ) AF: 0.750 AC: 2487 AN: 3314

East Asian (EAS) AF: 0.544 AC: 2464 AN: 4528

South Asian (SAS) AF: 0.232 AC: 1011 AN: 4358

European-Finnish (FIN) AF: 0.632 AC: 5292 AN: 8374

Middle Eastern (MID) AF: 0.752 AC: 203 AN: 270

European-Non Finnish (NFE) AF: 0.669 AC: 42407 AN: 63372

Other (OTH) AF: 0.623 AC: 1152 AN: 1848

Alfa AF: 0.273 Hom.: 898

Asia WGS AF: 0.438 AC: 1519 AN: 3470

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

not provided Other:1

Devine Lab Institute for Genome Sciences, University of Maryland School of Medicine

Significance: not provided

Review Status: no classification provided

Collection Method: not provided

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs66698963; hg19: chr11-61602496; COSMIC: COSV53900542;