rs66698963

chr11-61835024-CCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTT-Cchr11-61835024-CCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTT-CCTCCCTGCCTCCCCAGGGACTTchr11-61835024-CCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTT-CCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTTCTCCCTGCCTCCCCAGGGACTT

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_004265.4(FADS2):c.208-2735_208-2692del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000943 in 137,868 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.000094 (0 hom., cov: 0)
• Consequence: FADS2 NM_004265.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.13

Genes affected

FADS2 (HGNC:3575): (fatty acid desaturase 2) The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
FADS2	NM_004265.4	c.208-2735_208-2692del		intron_variant		ENST00000278840.9
FADS2	NM_001281501.1	c.142-2735_142-2692del		intron_variant
FADS2	NM_001281502.1	c.115-2735_115-2692del		intron_variant
FADS2	XM_047427889.1	c.208-2735_208-2692del		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
FADS2	ENST00000278840.9	c.208-2735_208-2692del		intron_variant		1	NM_004265.4	P1

Frequencies

GnomAD3 genomes AF: 0.0000943 AC: 13 AN: 137868 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000270

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000373

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000110

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000943 AC: 13 AN: 137868 Hom.: 0 Cov.: 0 AF XY: 0.0000603 AC XY: 4 AN XY: 66316

Gnomad4 AFR AF: 0.0000270

Gnomad4 AMR AF: 0.000373

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000110

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs66698963; hg19: chr11-61602496;