11-65539082-A-AGCGGCGGCGCTGGGGAACGCAGGCCCCGTGCGG

Variant names:

• chr11-65539082-A-AGCGGCGGCGCTGGGGAACGCAGGCCCCGTGCGG
• NM_001130144.3:c.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 3P and 1B. PM2 PP5 BP3

The NM_001130144.3(LTBP3):​c.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC​(p.Arg1303_Ter1304insProHisGlyAlaCysValProGlnArgArgArg) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: LTBP3 NM_001130144.3 conservative_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:2 U:1
• Conservation: PhyloP100: 0.913

Genes affected

LTBP3 (HGNC:6716): (latent transforming growth factor beta binding protein 3) The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-65539082-A-AGCGGCGGCGCTGGGGAACGCAGGCCCCGTGCGG is Pathogenic according to our data. Variant chr11-65539082-A-AGCGGCGGCGCTGGGGAACGCAGGCCCCGTGCGG is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 1393598.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=1, Uncertain_significance=1, Pathogenic=1}.
• BP3: Nonframeshift variant in repetitive region in NM_001130144.3

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LTBP3	NM_001130144.3	c.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC	p.Arg1303_Ter1304insProHisGlyAlaCysValProGlnArgArgArg	conservative_inframe_insertion	Exon 28 of 28	ENST00000301873.11	NP_001123616.1
LTBP3	NM_021070.4	c.3736_3768dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC	p.Arg1256_Ter1257insProHisGlyAlaCysValProGlnArgArgArg	conservative_inframe_insertion	Exon 27 of 27		NP_066548.2
LTBP3	NM_001164266.1	c.3385_3417dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC	p.Arg1139_Ter1140insProHisGlyAlaCysValProGlnArgArgArg	conservative_inframe_insertion	Exon 27 of 27		NP_001157738.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LTBP3	ENST00000301873.11	c.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC	p.Arg1303_Ter1304insProHisGlyAlaCysValProGlnArgArgArg	conservative_inframe_insertion	Exon 28 of 28	2	NM_001130144.3	ENSP00000301873.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:2 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Brachyolmia-amelogenesis imperfecta syndrome Pathogenic:1 Uncertain:1

Jun 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.3877_3909dup, results in the insertion of 11 amino acid(s) of the LTBP3 protein (p.Pro1293_Arg1303dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with LTBP3-related conditions. ClinVar contains an entry for this variant (Variation ID: 1393598). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

May 04, 2022

Mendelics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

May 17, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame duplication of 11 amino acids in a non-repeat region; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-65306553;