NM_001130144.3:c.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 3P and 1B. PM2PP5BP3

The NM_001130144.3(LTBP3):​c.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC​(p.Arg1303_Ter1304insProHisGlyAlaCysValProGlnArgArgArg) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

LTBP3
NM_001130144.3 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:2U:1

Conservation

PhyloP100: 0.913
Variant links:
Genes affected
LTBP3 (HGNC:6716): (latent transforming growth factor beta binding protein 3) The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-65539082-A-AGCGGCGGCGCTGGGGAACGCAGGCCCCGTGCGG is Pathogenic according to our data. Variant chr11-65539082-A-AGCGGCGGCGCTGGGGAACGCAGGCCCCGTGCGG is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 1393598.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=1, Uncertain_significance=1, Pathogenic=1}.
BP3
Nonframeshift variant in repetitive region in NM_001130144.3

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
LTBP3NM_001130144.3 linkc.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC p.Arg1303_Ter1304insProHisGlyAlaCysValProGlnArgArgArg conservative_inframe_insertion Exon 28 of 28 ENST00000301873.11 NP_001123616.1 Q9NS15-1Q8WYU6
LTBP3NM_021070.4 linkc.3736_3768dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC p.Arg1256_Ter1257insProHisGlyAlaCysValProGlnArgArgArg conservative_inframe_insertion Exon 27 of 27 NP_066548.2 Q9NS15-2Q8WYU6
LTBP3NM_001164266.1 linkc.3385_3417dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC p.Arg1139_Ter1140insProHisGlyAlaCysValProGlnArgArgArg conservative_inframe_insertion Exon 27 of 27 NP_001157738.1 Q9NS15B9EG76Q8WYU6

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
LTBP3ENST00000301873.11 linkc.3877_3909dupCCGCACGGGGCCTGCGTTCCCCAGCGCCGCCGC p.Arg1303_Ter1304insProHisGlyAlaCysValProGlnArgArgArg conservative_inframe_insertion Exon 28 of 28 2 NM_001130144.3 ENSP00000301873.5 Q9NS15-1

Frequencies

GnomAD3 genomes
Cov.:
33
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Conflicting classifications of pathogenicity
Submissions summary: Pathogenic:2Uncertain:1
Revision: criteria provided, conflicting classifications
LINK: link

Submissions by phenotype

Brachyolmia-amelogenesis imperfecta syndrome Pathogenic:1Uncertain:1
Jun 10, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.3877_3909dup, results in the insertion of 11 amino acid(s) of the LTBP3 protein (p.Pro1293_Arg1303dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with LTBP3-related conditions. ClinVar contains an entry for this variant (Variation ID: 1393598). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

May 04, 2022
Mendelics
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

not provided Pathogenic:1
May 17, 2024
GeneDx
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In-frame duplication of 11 amino acids in a non-repeat region; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-65306553; API