11-66070573-TCAGCAGCCGCCGCCGCAGCAGCAGCAG-T
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_018026.4(PACS1):c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC(p.Pro34_Pro42del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000299 in 1,335,630 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. P34P) has been classified as Benign.
Frequency
Consequence
NM_018026.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Schuurs-Hoeijmakers syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Orphanet, ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_018026.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PACS1 | TSL:1 MANE Select | c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC | p.Pro34_Pro42del | disruptive_inframe_deletion | Exon 1 of 24 | ENSP00000316454.4 | Q6VY07-1 | ||
| PACS1 | TSL:2 | n.225_251delCGCAGCAGCAGCAGCAGCAGCCGCCGC | non_coding_transcript_exon | Exon 1 of 7 | |||||
| ENSG00000255038 | n.29+430_29+456delCTGCTGCTGCTGCGGCGGCGGCTGCTG | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD2 exomes AF: 0.0000112 AC: 1AN: 89510 AF XY: 0.0000197 show subpopulations
GnomAD4 exome AF: 0.00000299 AC: 4AN: 1335630Hom.: 0 AF XY: 0.00000455 AC XY: 3AN XY: 658800 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at