11-66070573-TCAGCAGCCGCCGCCGCAGCAGCAGCAG-T

Variant names:

• chr11-66070573-TCAGCAGCCGCCGCCGCAGCAGCAGCAG-T
• rs1438611816
• NM_018026.4:c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_018026.4(PACS1):​c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC​(p.Pro34_Pro42del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000299 in 1,335,630 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000030 (0 hom.)
• Consequence: PACS1 NM_018026.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 1.85

Genes affected

PACS1 (HGNC:30032): (phosphofurin acidic cluster sorting protein 1) This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PACS1	NM_018026.4	c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC	p.Pro34_Pro42del	disruptive_inframe_deletion	Exon 1 of 24	ENST00000320580.9	NP_060496.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PACS1	ENST00000320580.9	c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC	p.Pro34_Pro42del	disruptive_inframe_deletion	Exon 1 of 24	1	NM_018026.4	ENSP00000316454.4
PACS1	ENST00000527224.1	n.225_251delCGCAGCAGCAGCAGCAGCAGCCGCCGC		non_coding_transcript_exon_variant	Exon 1 of 7	2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD3 exomes AF: 0.0000112 AC: 1 AN: 89510 Hom.: 0 AF XY: 0.0000197 AC XY: 1 AN XY: 50754

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000529

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000299 AC: 4 AN: 1335630 Hom.: 0 AF XY: 0.00000455 AC XY: 3 AN XY: 658800

Gnomad4 AFR exome AF: 0.0000369

Gnomad4 AMR exome AF: 0.0000328

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000134

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.46e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

Bravo AF: 0.0000151

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

PACS1-related disorder Uncertain:1

Feb 22, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The PACS1 c.101_127del27 variant is predicted to result in an in-frame deletion (p.Pro34_Pro42del). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.0053% of alleles in individuals of Latino descent in gnomAD. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1438611816; hg19: chr11-65838044;