rs1438611816
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_018026.4(PACS1):c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC(p.Pro34_Pro42del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000299 in 1,335,630 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_018026.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PACS1 | NM_018026.4 | c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC | p.Pro34_Pro42del | disruptive_inframe_deletion | Exon 1 of 24 | ENST00000320580.9 | NP_060496.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PACS1 | ENST00000320580.9 | c.101_127delCGCAGCAGCAGCAGCAGCAGCCGCCGC | p.Pro34_Pro42del | disruptive_inframe_deletion | Exon 1 of 24 | 1 | NM_018026.4 | ENSP00000316454.4 | ||
PACS1 | ENST00000527224.1 | n.225_251delCGCAGCAGCAGCAGCAGCAGCCGCCGC | non_coding_transcript_exon_variant | Exon 1 of 7 | 2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 exomes AF: 0.0000112 AC: 1AN: 89510Hom.: 0 AF XY: 0.0000197 AC XY: 1AN XY: 50754
GnomAD4 exome AF: 0.00000299 AC: 4AN: 1335630Hom.: 0 AF XY: 0.00000455 AC XY: 3AN XY: 658800
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
PACS1-related disorder Uncertain:1
The PACS1 c.101_127del27 variant is predicted to result in an in-frame deletion (p.Pro34_Pro42del). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.0053% of alleles in individuals of Latino descent in gnomAD. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at