11-66070581-CGCCGCCGCAGCAGCAGCAGCAGCA-C
Variant summary
Our verdict is Likely benign. Variant got -6 ACMG points: 0P and 6B. BP6_ModerateBS2
The NM_018026.4(PACS1):c.110_133delAGCAGCAGCAGCCGCCGCAGCAGC(p.Gln37_Gln44del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000288 in 1,493,540 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_018026.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PACS1 | NM_018026.4 | c.110_133delAGCAGCAGCAGCCGCCGCAGCAGC | p.Gln37_Gln44del | disruptive_inframe_deletion | Exon 1 of 24 | ENST00000320580.9 | NP_060496.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PACS1 | ENST00000320580.9 | c.110_133delAGCAGCAGCAGCCGCCGCAGCAGC | p.Gln37_Gln44del | disruptive_inframe_deletion | Exon 1 of 24 | 1 | NM_018026.4 | ENSP00000316454.4 | ||
PACS1 | ENST00000527224.1 | n.234_257delAGCAGCAGCAGCCGCCGCAGCAGC | non_coding_transcript_exon_variant | Exon 1 of 7 | 2 |
Frequencies
GnomAD3 genomes AF: 0.0000593 AC: 9AN: 151668Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000211 AC: 2AN: 94962Hom.: 0 AF XY: 0.0000370 AC XY: 2AN XY: 54004
GnomAD4 exome AF: 0.0000253 AC: 34AN: 1341872Hom.: 0 AF XY: 0.0000226 AC XY: 15AN XY: 662330
GnomAD4 genome AF: 0.0000593 AC: 9AN: 151668Hom.: 0 Cov.: 32 AF XY: 0.0000675 AC XY: 5AN XY: 74062
ClinVar
Submissions by phenotype
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at