rs756417166

Variant names:

• chr11-66070581-CGCCGCCGCAGCAGCAGCAGCAGCA-C
• rs756417166
• NM_018026.4:c.110_133delAGCAGCAGCAGCCGCCGCAGCAGC

Your query was ambiguous. Multiple possible variants found:

• chr11-66070581-CGCCGCCGCAGCAGCAGCAGCAGCA-C
• chr11-66070581-CGCCGCCGCAGCAGCAGCAGCAGCA-CGCCGCCGCAGCAGCAGCAGCAGCAGCCGCCGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The NM_018026.4(PACS1):​c.110_133delAGCAGCAGCAGCCGCCGCAGCAGC​(p.Gln37_Gln44del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000288 in 1,493,540 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.000059 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000025 (0 hom.)
• Consequence: PACS1 NM_018026.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.79
• Publications: 0 publications found

Genes affected

PACS1 (HGNC:30032): (phosphofurin acidic cluster sorting protein 1) This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

PACS1 Gene-Disease associations (from GenCC):

• Schuurs-Hoeijmakers syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Orphanet, ClinGen

ENSG00000255038 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_018026.4
• BP6: Variant 11-66070581-CGCCGCCGCAGCAGCAGCAGCAGCA-C is Benign according to our data. Variant chr11-66070581-CGCCGCCGCAGCAGCAGCAGCAGCA-C is described in ClinVar as Likely_benign. ClinVar VariationId is 2231094.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAd4 at 9 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018026.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PACS1	NM_018026.4	MANE Select	c.110_133delAGCAGCAGCAGCCGCCGCAGCAGC	p.Gln37_Gln44del	disruptive_inframe_deletion	Exon 1 of 24	NP_060496.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PACS1	ENST00000320580.9	TSL:1 MANE Select	c.110_133delAGCAGCAGCAGCCGCCGCAGCAGC	p.Gln37_Gln44del	disruptive_inframe_deletion	Exon 1 of 24	ENSP00000316454.4	Q6VY07-1
	PACS1	ENST00000527224.1	TSL:2	n.234_257delAGCAGCAGCAGCCGCCGCAGCAGC		non_coding_transcript_exon	Exon 1 of 7
	ENSG00000255038	ENST00000830157.1		n.29+425_29+448delTGCTGCTGCTGCTGCTGCGGCGGC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.0000593 AC: 9 AN: 151668 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000145

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000442

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000211 AC: 2 AN: 94962 AF XY: 0.0000370

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000281

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000253 AC: 34 AN: 1341872 Hom.: 0 AF XY: 0.0000226 AC XY: 15 AN XY: 662330

African (AFR) AF: 0.0000734 AC: 2 AN: 27240

American (AMR) AF: 0.00 AC: 0 AN: 31046

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23558

East Asian (EAS) AF: 0.0000336 AC: 1 AN: 29758

South Asian (SAS) AF: 0.0000266 AC: 2 AN: 75224

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 34000

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4184

European-Non Finnish (NFE) AF: 0.0000273 AC: 29 AN: 1060988

Other (OTH) AF: 0.00 AC: 0 AN: 55874

GnomAD4 genome AF: 0.0000593 AC: 9 AN: 151668 Hom.: 0 Cov.: 32 AF XY: 0.0000675 AC XY: 5 AN XY: 74062

African (AFR) AF: 0.000145 AC: 6 AN: 41360

American (AMR) AF: 0.00 AC: 0 AN: 15230

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5140

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10492

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000442 AC: 3 AN: 67844

Other (OTH) AF: 0.00 AC: 0 AN: 2086

Alfa AF: 0.0000389 Hom.: 0

Bravo AF: 0.0000340

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8
Mutation Taster		=179/21	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs756417166; hg19: chr11-65838052;