11-67606993-TGGCCCGCCGCGATGCTGGCAACAC-T

Variant names:

• chr11-67606993-TGGCCCGCCGCGATGCTGGCAACAC-T
• rs1316287327
• NM_007103.4:c.-8_16delCCGCCGCGATGCTGGCAACACGGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_007103.4(NDUFV1):​c.-8_16delCCGCCGCGATGCTGGCAACACGGC​(p.Met1_Arg6del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000559 in 1,608,880 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: NDUFV1 NM_007103.4 start_lost, conservative_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.14

Genes affected

NDUFV1 (HGNC:7716): (NADH:ubiquinone oxidoreductase core subunit V1) The mitochondrial respiratory chain provides energy to cells via oxidative phosphorylation and consists of four membrane-bound electron-transporting protein complexes (I-IV) and an ATP synthase (complex V). This gene encodes a 51 kDa subunit of the NADH:ubiquinone oxidoreductase complex I; a large complex with at least 45 nuclear and mitochondrial encoded subunits that liberates electrons from NADH and channels them to ubiquinone. This subunit carries the NADH-binding site as well as flavin mononucleotide (FMN)- and Fe-S-biding sites. Defects in complex I are a common cause of mitochondrial dysfunction; a syndrome that occurs in approximately 1 in 10,000 live births. Mitochondrial complex I deficiency is linked to myopathies, encephalomyopathies, and neurodegenerative disorders such as Parkinson's disease and Leigh syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-67606993-TGGCCCGCCGCGATGCTGGCAACAC-T is Pathogenic according to our data. Variant chr11-67606993-TGGCCCGCCGCGATGCTGGCAACAC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2504038.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NDUFV1	NM_007103.4	c.-8_16delCCGCCGCGATGCTGGCAACACGGC	p.Met1_Arg6del	start_lost, conservative_inframe_deletion	Exon 1 of 10	ENST00000322776.11	NP_009034.2
NDUFV1	NM_007103.4	c.-8_16delCCGCCGCGATGCTGGCAACACGGC		5_prime_UTR_variant	Exon 1 of 10	ENST00000322776.11	NP_009034.2
NDUFV1	NM_001166102.2	c.-8_16delCCGCCGCGATGCTGGCAACACGGC	p.Met1_Arg6del	start_lost, conservative_inframe_deletion	Exon 1 of 10		NP_001159574.1
NDUFV1	NM_001166102.2	c.-8_16delCCGCCGCGATGCTGGCAACACGGC		5_prime_UTR_variant	Exon 1 of 10		NP_001159574.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NDUFV1	ENST00000322776.11	c.-8_16delCCGCCGCGATGCTGGCAACACGGC	p.Met1_Arg6del	start_lost, conservative_inframe_deletion	Exon 1 of 10	1	NM_007103.4	ENSP00000322450.6
NDUFV1	ENST00000322776	c.-8_16delCCGCCGCGATGCTGGCAACACGGC		5_prime_UTR_variant	Exon 1 of 10	1	NM_007103.4	ENSP00000322450.6

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152204 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000549 AC: 8 AN: 1456676 Hom.: 0 AF XY: 0.00000828 AC XY: 6 AN XY: 724262

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000720

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152204 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74354

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000147

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Leigh syndrome Pathogenic:1

Apr 12, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: NDUFV1 c.-8_16del24 (NA) alters the initiation codon and is predicted to result either in absence of the protein or truncation of the encoded protein due to translation initiation at a downstream codon. The next downstream initiation codon is at Met102. Truncations variants upstream of this initiation codon have been classified as pathogenic by our laboratory. The variant was absent in 235692 control chromosomes. To our knowledge, no occurrence of c.-8_16del24 in individuals affected with Leigh Syndrome and no experimental evidence demonstrating its impact on protein function have been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as likely pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1316287327; hg19: chr11-67374464;